Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049015 Citrobacter freundii ATCC 8090 = MTCC 1658 = NBRC 12681 strain ATCC 8090 chromosome, complete genome 1 crisprs DEDDh,WYL,DinG,cas3,csa3 0 1 8 0

Results visualization

1. NZ_CP049015
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049015_1 2256190-2256313 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049015_1 1.1|2256233|38|NZ_CP049015|CRISPRCasFinder 2256233-2256270 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 3 0.921

1. spacer 1.1|2256233|38|NZ_CP049015|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 3, identity: 0.921

cggacgcaagatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.******..****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1280818 : 1342790 70 Enterobacteria_phage(52.5%) head,integrase,plate,protease,capsid,tRNA,terminase,portal,tail attL 1275688:1275704|attR 1338885:1338901
DBSCAN-SWA_2 2057363 : 2063590 11 Klebsiella_phage(28.57%) NA NA
DBSCAN-SWA_3 2161752 : 2171790 10 Tupanvirus(14.29%) tRNA NA
DBSCAN-SWA_4 2545604 : 2552257 6 Salmonella_phage(33.33%) transposase NA
DBSCAN-SWA_5 2793189 : 2906456 145 Enterobacteria_phage(29.89%) head,integrase,tail,transposase,holin,capsid,tRNA,terminase,portal,protease attL 2823838:2823853|attR 2915515:2915530
DBSCAN-SWA_6 3071867 : 3080089 8 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_7 3174218 : 3182637 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 4219217 : 4258180 43 Cronobacter_phage(73.53%) head,integrase,capsid,tRNA,terminase,portal,tail attL 4241034:4241048|attR 4263316:4263330
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage