Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049757 Pasteurella multocida strain KVNON-213 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP049756 Pasteurella multocida strain KVNON-213 chromosome, complete genome 5 crisprs cas3,csa3,cas9,cas1,cas2,DEDDh,DinG,cas3-cas2,cas6f,cas7f,cas5f,cas8f 1 20 6 0

Results visualization

1. NZ_CP049756
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049756_1 286180-288010 Unclear I-F
30 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049756_2 1056213-1056644 TypeII NA
6 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049756_3 1630260-1631216 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049756_4 1701755-1701838 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049756_5 2107283-2107849 TypeI-F NA
9 spacers
cas1,cas3-cas2,cas6f,cas7f,cas5f,cas8f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP049756_2 2.1|1056249|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056249-1056278 30 NZ_CP049756.1 1598887-1598916 0 1.0

1. spacer 2.1|1056249|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to position: 1598887-1598916, mismatch: 0, identity: 1.0 

ttaagtatttcgcgctattaaattcaactt	CRISPR spacer
ttaagtatttcgcgctattaaattcaactt	Protospacer
******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049756_1 1.13|286928|33|NZ_CP049756|CRISPRCasFinder,CRT 286928-286960 33 MH238467 Pasteurella phage Pm86, complete genome 36064-36096 0 1.0
NZ_CP049756_1 1.14|286989|32|NZ_CP049756|CRISPRCasFinder,CRT 286989-287020 32 MH238467 Pasteurella phage Pm86, complete genome 29856-29887 0 1.0
NZ_CP049756_1 1.15|287049|32|NZ_CP049756|CRISPRCasFinder,CRT 287049-287080 32 MH238467 Pasteurella phage Pm86, complete genome 32414-32445 0 1.0
NZ_CP049756_1 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT 286628-286659 32 NZ_CP009359 Vibrio tubiashii ATCC 19109 plasmid p48, complete sequence 46009-46040 5 0.844
NZ_CP049756_5 5.6|2107610|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 2107610-2107641 32 NZ_CP014688 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence 363039-363070 5 0.844
NZ_CP049756_1 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT 286628-286659 32 NZ_CP054197 Glaesserella parasuis strain YHP170504 plasmid unnamed1, complete sequence 16532-16563 6 0.812
NZ_CP049756_1 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT 286628-286659 32 NC_007206 Haemophilus influenzae biotype aegyptius plasmid pF1947, complete sequence 136-167 6 0.812
NZ_CP049756_1 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT 286628-286659 32 NC_004846 Haemophilus influenzae biotype aegyptius plasmid pF3031, complete sequence 136-167 6 0.812
NZ_CP049756_1 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT 286628-286659 32 NC_004058 Haemophilus influenzae biotype aegyptius BPF plasmid pF3028, complete sequence 136-167 6 0.812
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 113799-113830 7 0.781
NZ_CP049756_1 1.9|286688|32|NZ_CP049756|CRISPRCasFinder,CRT 286688-286719 32 MN693061 Marine virus AFVG_25M430, complete genome 8832-8863 7 0.781
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NZ_KY290886 Enterococcus faecalis strain Transconjugant T4 plasmid pJH-T4, complete sequence 4990-5019 7 0.767
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NZ_CP014451 Enterococcus faecium strain ATCC 700221 plasmid unnamed2, complete sequence 45455-45484 7 0.767
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NZ_LR135299 Enterococcus faecium isolate E7429 plasmid 3 57075-57104 7 0.767
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NZ_LR135341 Enterococcus faecium isolate E7356 plasmid 3 15384-15413 7 0.767
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NZ_CP027515 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed3, complete sequence 51664-51693 7 0.767
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NC_011364 Enterococcus faecium plasmid pMG1, complete sequence 12499-12528 7 0.767
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NZ_CP014535 Enterococcus faecium strain E745 plasmid pl6, complete sequence 11262-11291 7 0.767
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NC_007594 Enterococcus faecium plasmid pHT beta, complete sequence 1877-1906 7 0.767
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 6822-6851 7 0.767
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NZ_CP019972 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-2 sequence 4710-4739 7 0.767
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 MN693011 Marine virus AFVG_117M58, complete genome 48548-48579 7 0.781
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 MN693011 Marine virus AFVG_117M58, complete genome 48548-48579 7 0.781
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 419234-419265 8 0.75
NZ_CP049756_1 1.6|286508|32|NZ_CP049756|CRISPRCasFinder,CRT 286508-286539 32 KC139544 Salmonella phage FSL SP-012 hypothetical protein gene, partial cds; and hypothetical proteins, thymidylate synthase, dihydrofolate reductase, hypothetical proteins, putative transcriptional regulatory protein, hypothetical proteins, ATP-dependent DNA ligase, hypothetical proteins, putative DNA polymerase, endonuclease, putative DNA polymerase, hypothetical proteins, putative deoxynucleotide monophosphate kinase, hypothetical protein, putative phage DNA primase/helicase, hypothetical proteins, putative exodeoxyribonuclease, hypothetical protein, NAD synthetase, hypothetical proteins, ribonucleoside triphosphate reductase alpha chain, hypothetical protein, ribonucleoside triphosphate reductase beta chain, putative glutaredoxin, hypothetical protein, ribonucleotide reductase of class III, homing endonuclease, ribonucleotide reductase of class III, hypothetical proteins, ribonucleotide reductase of class III, hypothetical proteins, putative ribose-phosphate pyrophosphokinase, nicotinamide phosphoribosyl transferase, hypothetical proteins, rIIA protein, rIIB protein, hypothetical protein, putative PseT polynucleotide 5'-kinase/3'-phosphatase, and hypothetical proteins genes, complete cds 20783-20814 8 0.75
NZ_CP049756_1 1.6|286508|32|NZ_CP049756|CRISPRCasFinder,CRT 286508-286539 32 KC139526 Salmonella phage FSL SP-010 hypothetical proteins, putative PseT polynucleotide 5'-kinase/3'-phosphatase, hypothetical protein, rIIB protein, rIIA protein, hypothetical proteins, nicotinamide phosphoribosyl transferase, putative ribose-phosphate pyrophosphokinase, hypothetical proteins, ribonucleotide reductase of class III, hypothetical proteins, ribonucleotide reductase of class III, HNH homing endonuclease, ribonucleotide reductase of class III, hypothetical protein, putative glutaredoxin, ribonucleoside triphosphate reductase, beta chain, hypothetical protein, ribonucleoside triphosphate reductase alpha chain, hypothetical proteins, NAD synthetase, putative HNH endonuclease, putative exodeoxyribonuclease, hypothetical proteins, putative phage DNA primase/helicase, hypothetical protein, putative deoxynucleotide monophosphate kinase, hypothetical proteins, putative DNA polymerase, endonuclease, putative DNA polymerase, hypothetical proteins, ATP-dependent DNA ligase, hypothetical proteins, putative transcriptional regulatory protein, hypothetical proteins, dihydrofolate reductase, thymidylate synthase, and hypothetical proteins genes, complete cds; and tail fiber protein gene, partial cds 21165-21196 8 0.75
NZ_CP049756_1 1.13|286928|33|NZ_CP049756|CRISPRCasFinder,CRT 286928-286960 33 NC_013502 Rhodothermus marinus DSM 4252 plasmid pRMAR01, complete sequence 80451-80483 8 0.758
NZ_CP049756_1 1.13|286928|33|NZ_CP049756|CRISPRCasFinder,CRT 286928-286960 33 NC_015970 Rhodothermus marinus SG0.5JP17-172 plasmid pRHOM17201, complete sequence 1869-1901 8 0.758
NZ_CP049756_1 1.16|287109|32|NZ_CP049756|CRISPRCasFinder,CRT 287109-287140 32 JX238501 Bacillus phage phiAGATE, complete genome 99415-99446 8 0.75
NZ_CP049756_1 1.30|287951|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 287951-287982 32 NZ_CP048306 Escherichia coli strain 9 plasmid p009_B, complete sequence 9049-9080 8 0.75
NZ_CP049756_1 1.30|287951|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 287951-287982 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 75917-75948 8 0.75
NZ_CP049756_1 1.30|287951|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 287951-287982 32 NZ_CP019027 Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence 91413-91444 8 0.75
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 MN693287 Marine virus AFVG_25M168, complete genome 19787-19816 8 0.733
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NZ_LR214999 Mycoplasma conjunctivae strain NCTC10147 plasmid 3 49900-49929 8 0.733
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 LR214965 Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 11 39492-39521 8 0.733
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 NZ_CP041255 Enterococcus faecium strain 515 plasmid p32, complete sequence 15293-15322 8 0.733
NZ_CP049756_2 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT 1056513-1056542 30 CP040041 Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence 173088-173117 8 0.733
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KX346250 Lactococcus phage MW18S, complete genome 27158-27189 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KP793114 Lactococcus phage 936 group phage Phi17, complete genome 26128-26159 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 NC_049361 Lactococcus phage 936 group phage PhiL.6, complete genome 26305-26336 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 NC_049367 Lactococcus phage 936 group phage PhiE1127, complete genome 26521-26552 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KX379672 Lactococcus phage 16W12L, complete genome 28063-28094 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 NC_049434 Lactococcus phage MP1, complete genome 27801-27832 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KX379673 Lactococcus phage MW18L, complete genome 28284-28315 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 NC_049373 Lactococcus phage 16W23, complete genome 27758-27789 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KP793132 Lactococcus phage 936 group phage PhiM1127, complete genome 27688-27719 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KP793135 Lactococcus phage 936 group phage Phi.16, complete genome 26578-26609 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KX346242 Lactococcus phage 8R06S, complete genome 26199-26230 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KP793128 Lactococcus phage 936 group phage PhiM.16, complete genome 27166-27197 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KP793126 Lactococcus phage 936 group phage PhiM.5, complete genome 26553-26584 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KM091443 Lactococcus phage phi93, complete genome 27086-27117 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 NC_049366 Lactococcus phage 936 group phage Phi155, complete genome 27019-27050 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KP793127 Lactococcus phage 936 group phage Phi40, complete genome 26676-26707 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 MK301441 Lactococcus phage MV16, complete genome 28249-28280 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KP793121 Lactococcus phage 936 group phage Phi109, complete genome 26251-26282 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KP793125 Lactococcus phage 936 group phage Phi91127, complete genome 26552-26583 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 NC_049446 Lactococcus phage 8V08, complete genome 27706-27737 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KM091444 Lactococcus phage phi145, complete genome 25930-25961 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 NC_049447 Lactococcus phage MV10L, complete genome 25518-25549 8 0.75
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 KP793120 Lactococcus phage 936 group phage PhiL.18, complete genome 26179-26210 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KX346250 Lactococcus phage MW18S, complete genome 27158-27189 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KP793114 Lactococcus phage 936 group phage Phi17, complete genome 26128-26159 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 NC_049361 Lactococcus phage 936 group phage PhiL.6, complete genome 26305-26336 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 NC_049367 Lactococcus phage 936 group phage PhiE1127, complete genome 26521-26552 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KX379672 Lactococcus phage 16W12L, complete genome 28063-28094 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 NC_049434 Lactococcus phage MP1, complete genome 27801-27832 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KX379673 Lactococcus phage MW18L, complete genome 28284-28315 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 NC_049373 Lactococcus phage 16W23, complete genome 27758-27789 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KP793132 Lactococcus phage 936 group phage PhiM1127, complete genome 27688-27719 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KP793135 Lactococcus phage 936 group phage Phi.16, complete genome 26578-26609 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KX346242 Lactococcus phage 8R06S, complete genome 26199-26230 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KP793128 Lactococcus phage 936 group phage PhiM.16, complete genome 27166-27197 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KP793126 Lactococcus phage 936 group phage PhiM.5, complete genome 26553-26584 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KM091443 Lactococcus phage phi93, complete genome 27086-27117 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 NC_049366 Lactococcus phage 936 group phage Phi155, complete genome 27019-27050 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KP793127 Lactococcus phage 936 group phage Phi40, complete genome 26676-26707 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 MK301441 Lactococcus phage MV16, complete genome 28249-28280 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KP793121 Lactococcus phage 936 group phage Phi109, complete genome 26251-26282 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KP793125 Lactococcus phage 936 group phage Phi91127, complete genome 26552-26583 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 NC_049446 Lactococcus phage 8V08, complete genome 27706-27737 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KM091444 Lactococcus phage phi145, complete genome 25930-25961 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 NC_049447 Lactococcus phage MV10L, complete genome 25518-25549 8 0.75
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 KP793120 Lactococcus phage 936 group phage PhiL.18, complete genome 26179-26210 8 0.75
NZ_CP049756_5 5.5|2107550|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 2107550-2107581 32 LT960552 Yersinia phage fHe-Yen9-03 genome assembly, complete genome: monopartite 51993-52024 8 0.75
NZ_CP049756_5 5.5|2107550|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 2107550-2107581 32 LR596615 Yersinia phage fHe-Yen9-04 genome assembly, chromosome: I 50163-50194 8 0.75
NZ_CP049756_5 5.5|2107550|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 2107550-2107581 32 NC_042116 Yersinia phage fHe-Yen9-04 genome assembly, complete genome: monopartite 50163-50194 8 0.75
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP011282 Enterococcus faecium strain E39 plasmid p1, complete sequence 66864-66895 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NC_018265 Melissococcus plutonius DAT561 plasmid 1, complete sequence 154555-154586 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 105535-105566 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP006684 Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence 42722-42753 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_AP021886 Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence 42723-42754 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 101066-101097 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 15600-15631 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP018073 Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence 21451-21482 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 102965-102996 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 83999-84030 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135288 Enterococcus faecium isolate E7199 plasmid 2 63258-63289 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135333 Enterococcus faecium isolate E7471 plasmid 3 70641-70672 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 114373-114404 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 249804-249835 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 81250-81281 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135244 Enterococcus faecium isolate E6988 plasmid 2 77783-77814 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 149171-149202 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135255 Enterococcus faecium isolate E7098 plasmid 2 60623-60654 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135236 Enterococcus faecium isolate E7067 plasmid 2 98869-98900 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 116124-116155 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135182 Enterococcus faecium isolate E1774 plasmid 2 66282-66313 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP041256 Enterococcus faecium strain 515 plasmid p26, complete sequence 76446-76477 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP019209 Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence 201973-202004 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 114712-114743 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP017798 Enterococcus faecium strain E243 plasmid unnamed1, complete sequence 65531-65562 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 93953-93984 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 169152-169183 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135227 Enterococcus faecium isolate E7025 plasmid 2 63716-63747 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 75770-75801 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 78921-78952 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135220 Enterococcus faecium isolate E7040 plasmid 2 100637-100668 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 82447-82478 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 82447-82478 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 19235-19266 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 83166-83197 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135325 Enterococcus faecium isolate E7654 plasmid 2 63661-63692 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 82447-82478 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 80934-80965 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 64107-64138 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135318 Enterococcus faecium isolate E7663 plasmid 2 63632-63663 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR134106 Enterococcus faecium isolate E6043 plasmid 2 99218-99249 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 6114-6145 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 90007-90038 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 93187-93218 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 96462-96493 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 170652-170683 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 80971-81002 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP017793 Enterococcus faecium strain E240 plasmid unnamed1, complete sequence 65531-65562 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 123370-123401 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 126034-126065 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 137554-137585 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_AP018525 Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence 42741-42772 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 101065-101096 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LR135308 Enterococcus faecium isolate E7240 plasmid 2 62307-62338 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 102624-102655 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 77104-77135 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 124701-124732 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP033207 Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence 27047-27078 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 127802-127833 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 124701-124732 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_AP019409 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence 63975-64006 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 71632-71663 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 105535-105566 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP012461 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence 125358-125389 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 126047-126078 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 123370-123401 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 76236-76267 9 0.719
NZ_CP049756_1 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT 286628-286659 32 NZ_CP007001 Campylobacter fetus subsp. venerealis cfvi03/293 plasmid pCfviMP2, complete sequence 4151-4182 9 0.719
NZ_CP049756_1 1.9|286688|32|NZ_CP049756|CRISPRCasFinder,CRT 286688-286719 32 MG592429 Vibrio phage 1.047.O._10N.286.55.F2, partial genome 25369-25400 9 0.719
NZ_CP049756_1 1.10|286748|32|NZ_CP049756|CRISPRCasFinder,CRT 286748-286779 32 MN692994 Marine virus AFVG_117M61, complete genome 46288-46319 9 0.719
NZ_CP049756_1 1.10|286748|32|NZ_CP049756|CRISPRCasFinder,CRT 286748-286779 32 MN692961 Marine virus AFVG_117M41, complete genome 44041-44072 9 0.719
NZ_CP049756_1 1.10|286748|32|NZ_CP049756|CRISPRCasFinder,CRT 286748-286779 32 MN693032 Marine virus AFVG_117M42, complete genome 45690-45721 9 0.719
NZ_CP049756_1 1.18|287229|32|NZ_CP049756|CRISPRCasFinder,CRT 287229-287260 32 NC_012855 Ralstonia pickettii 12D plasmid pRp12D01, complete sequence 161699-161730 9 0.719
NZ_CP049756_3 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT 1631007-1631038 32 MK448711 Streptococcus phage Javan235, complete genome 41398-41429 9 0.719
NZ_CP049756_3 3.23|1631008|32|NZ_CP049756|PILER-CR 1631008-1631039 32 MK448711 Streptococcus phage Javan235, complete genome 41398-41429 9 0.719
NZ_CP049756_5 5.4|2107490|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 2107490-2107521 32 MN657092 Psychrobacter sp. strain ANT_P40 plasmid pA40P3, complete sequence 3839-3870 9 0.719
NZ_CP049756_5 5.4|2107490|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 2107490-2107521 32 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 471832-471863 9 0.719
NZ_CP049756_5 5.6|2107610|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 2107610-2107641 32 NC_018878 Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence 128114-128145 9 0.719
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP029455 Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence 406694-406725 10 0.688
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 NZ_CP014203 Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence 48961-48992 10 0.688
NZ_CP049756_1 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT 286208-286239 32 MN693757 Marine virus AFVG_250M21, complete genome 43391-43422 10 0.688
NZ_CP049756_1 1.6|286508|32|NZ_CP049756|CRISPRCasFinder,CRT 286508-286539 32 NZ_CP024792 Nostoc flagelliforme CCNUN1 plasmid pNFSY07, complete sequence 156435-156466 10 0.688
NZ_CP049756_1 1.21|287411|32|NZ_CP049756|CRISPRCasFinder,CRT 287411-287442 32 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 183086-183117 10 0.688
NZ_CP049756_1 1.21|287411|32|NZ_CP049756|CRISPRCasFinder,CRT 287411-287442 32 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 188811-188842 10 0.688
NZ_CP049756_1 1.22|287471|32|NZ_CP049756|CRISPRCasFinder,CRT 287471-287502 32 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 183086-183117 10 0.688
NZ_CP049756_1 1.22|287471|32|NZ_CP049756|CRISPRCasFinder,CRT 287471-287502 32 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 188811-188842 10 0.688
NZ_CP049756_1 1.25|287651|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR 287651-287682 32 MK448659 Streptococcus satellite phage Javan89, complete genome 7356-7387 10 0.688

1. spacer 1.13|286928|33|NZ_CP049756|CRISPRCasFinder,CRT matches to MH238467 (Pasteurella phage Pm86, complete genome) position: , mismatch: 0, identity: 1.0 

attgagcgcgatgtcgcaagcaaagcgttgatt	CRISPR spacer
attgagcgcgatgtcgcaagcaaagcgttgatt	Protospacer
*********************************

2. spacer 1.14|286989|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MH238467 (Pasteurella phage Pm86, complete genome) position: , mismatch: 0, identity: 1.0 

ttatgcgtcgatttttaacgttagcaaatggt	CRISPR spacer
ttatgcgtcgatttttaacgttagcaaatggt	Protospacer
********************************

3. spacer 1.15|287049|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MH238467 (Pasteurella phage Pm86, complete genome) position: , mismatch: 0, identity: 1.0 

aaactgaggctggatgaatgtgaattaaataa	CRISPR spacer
aaactgaggctggatgaatgtgaattaaataa	Protospacer
********************************

4. spacer 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP009359 (Vibrio tubiashii ATCC 19109 plasmid p48, complete sequence) position: , mismatch: 5, identity: 0.844 

ttgaaatttgcggtaactggatttggttaagt	CRISPR spacer
ttgaaatctgtggtaactggatttggatcggt	Protospacer
*******.**.*************** * .**

5. spacer 5.6|2107610|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014688 (Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence) position: , mismatch: 5, identity: 0.844 

--ttatcaatgatgctttccaagtagataaagaa	CRISPR spacer
gattatc--tgatgctttcccagaagataaagac	Protospacer
  *****  *********** ** *********

6. spacer 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP054197 (Glaesserella parasuis strain YHP170504 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

ttgaaatttgcggtaactggatttggttaagt	CRISPR spacer
tcgaaatttgcggtaactggttgtggttatcg	Protospacer
*.****************** * ******

7. spacer 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_007206 (Haemophilus influenzae biotype aegyptius plasmid pF1947, complete sequence) position: , mismatch: 6, identity: 0.812 

ttgaaatttgcggtaactggatttggttaagt	CRISPR spacer
ttgaggtttgcggtaactggatttggcttgct	Protospacer
****..********************.* . *

8. spacer 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_004846 (Haemophilus influenzae biotype aegyptius plasmid pF3031, complete sequence) position: , mismatch: 6, identity: 0.812 

ttgaaatttgcggtaactggatttggttaagt	CRISPR spacer
ttgaggtttgcggtaactggatttggctggct	Protospacer
****..********************.*.. *

9. spacer 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_004058 (Haemophilus influenzae biotype aegyptius BPF plasmid pF3028, complete sequence) position: , mismatch: 6, identity: 0.812 

ttgaaatttgcggtaactggatttggttaagt	CRISPR spacer
ttgaggtttgcggtaactggatttggctggct	Protospacer
****..********************.*.. *

10. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 7, identity: 0.781 

agctatcat-atttattagataaattacaattt	CRISPR spacer
-acactgatgatttatttgataaattagaattt	Protospacer
 .*  * ** ******* ********* *****

11. spacer 1.9|286688|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MN693061 (Marine virus AFVG_25M430, complete genome) position: , mismatch: 7, identity: 0.781 

ttcatcatctacaacctttagccctactgata	CRISPR spacer
ttcattatctccaacctttagcccatcagcaa	Protospacer
*****.**** *************  * *  *

12. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY290886 (Enterococcus faecalis strain Transconjugant T4 plasmid pJH-T4, complete sequence) position: , mismatch: 7, identity: 0.767 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
acaagataagcactatattttttattgtct	Protospacer
.**...*******.**************.

13. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014451 (Enterococcus faecium strain ATCC 700221 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
acaagataagcactatattttttattgtct	Protospacer
.**...*******.**************.

14. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR135299 (Enterococcus faecium isolate E7429 plasmid 3) position: , mismatch: 7, identity: 0.767 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
acaagataagcactatattttttattgtct	Protospacer
.**...*******.**************.

15. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR135341 (Enterococcus faecium isolate E7356 plasmid 3) position: , mismatch: 7, identity: 0.767 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
acaagataagcactatattttttattgtct	Protospacer
.**...*******.**************.

16. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027515 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
acaagataagcactatattttttattgtct	Protospacer
.**...*******.**************.

17. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NC_011364 (Enterococcus faecium plasmid pMG1, complete sequence) position: , mismatch: 7, identity: 0.767 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
acaagataagcactatattttttattgtct	Protospacer
.**...*******.**************.

18. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014535 (Enterococcus faecium strain E745 plasmid pl6, complete sequence) position: , mismatch: 7, identity: 0.767 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
acaagataagcactatattttttattgtct	Protospacer
.**...*******.**************.

19. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NC_007594 (Enterococcus faecium plasmid pHT beta, complete sequence) position: , mismatch: 7, identity: 0.767 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
acaagataagcactatattttttattgtct	Protospacer
.**...*******.**************.

20. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 7, identity: 0.767 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
acaagataagcactatattttttattgtct	Protospacer
.**...*******.**************.

21. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019972 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-2 sequence) position: , mismatch: 7, identity: 0.767 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
acaagataagcactatattttttattgtct	Protospacer
.**...*******.**************.

22. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MN693011 (Marine virus AFVG_117M58, complete genome) position: , mismatch: 7, identity: 0.781 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
aattagagtatggaggactaaataatggaaaa	Protospacer
* ** .*  ************  *********

23. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to MN693011 (Marine virus AFVG_117M58, complete genome) position: , mismatch: 7, identity: 0.781 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
aattagagtatggaggactaaataatggaaaa	Protospacer
* ** .*  ************  *********

24. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 8, identity: 0.75 

agctatcatatttattagataaattacaattt	CRISPR spacer
atactaaatattttttaaataaattacaattt	Protospacer
*  .   ****** ***.**************

25. spacer 1.6|286508|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KC139544 (Salmonella phage FSL SP-012 hypothetical protein gene, partial cds; and hypothetical proteins, thymidylate synthase, dihydrofolate reductase, hypothetical proteins, putative transcriptional regulatory protein, hypothetical proteins, ATP-dependent DNA ligase, hypothetical proteins, putative DNA polymerase, endonuclease, putative DNA polymerase, hypothetical proteins, putative deoxynucleotide monophosphate kinase, hypothetical protein, putative phage DNA primase/helicase, hypothetical proteins, putative exodeoxyribonuclease, hypothetical protein, NAD synthetase, hypothetical proteins, ribonucleoside triphosphate reductase alpha chain, hypothetical protein, ribonucleoside triphosphate reductase beta chain, putative glutaredoxin, hypothetical protein, ribonucleotide reductase of class III, homing endonuclease, ribonucleotide reductase of class III, hypothetical proteins, ribonucleotide reductase of class III, hypothetical proteins, putative ribose-phosphate pyrophosphokinase, nicotinamide phosphoribosyl transferase, hypothetical proteins, rIIA protein, rIIB protein, hypothetical protein, putative PseT polynucleotide 5'-kinase/3'-phosphatase, and hypothetical proteins genes, complete cds) position: , mismatch: 8, identity: 0.75 

cttctggttgcagtctgcgctgcttttgttgc	CRISPR spacer
tcacatcttgcagtctgcggtgctttggttgc	Protospacer
.. *   ************ ****** *****

26. spacer 1.6|286508|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KC139526 (Salmonella phage FSL SP-010 hypothetical proteins, putative PseT polynucleotide 5'-kinase/3'-phosphatase, hypothetical protein, rIIB protein, rIIA protein, hypothetical proteins, nicotinamide phosphoribosyl transferase, putative ribose-phosphate pyrophosphokinase, hypothetical proteins, ribonucleotide reductase of class III, hypothetical proteins, ribonucleotide reductase of class III, HNH homing endonuclease, ribonucleotide reductase of class III, hypothetical protein, putative glutaredoxin, ribonucleoside triphosphate reductase, beta chain, hypothetical protein, ribonucleoside triphosphate reductase alpha chain, hypothetical proteins, NAD synthetase, putative HNH endonuclease, putative exodeoxyribonuclease, hypothetical proteins, putative phage DNA primase/helicase, hypothetical protein, putative deoxynucleotide monophosphate kinase, hypothetical proteins, putative DNA polymerase, endonuclease, putative DNA polymerase, hypothetical proteins, ATP-dependent DNA ligase, hypothetical proteins, putative transcriptional regulatory protein, hypothetical proteins, dihydrofolate reductase, thymidylate synthase, and hypothetical proteins genes, complete cds; and tail fiber protein gene, partial cds) position: , mismatch: 8, identity: 0.75 

cttctggttgcagtctgcgctgcttttgttgc	CRISPR spacer
tcacatcttgcagtctgcggtgctttggttgc	Protospacer
.. *   ************ ****** *****

27. spacer 1.13|286928|33|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_013502 (Rhodothermus marinus DSM 4252 plasmid pRMAR01, complete sequence) position: , mismatch: 8, identity: 0.758 

attgagcgcgatgtcgcaagcaaagcgttgatt	CRISPR spacer
cgtgagcgccatgtcgcacgcaaagcgcaaagt	Protospacer
  ******* ******** ********. .* *

28. spacer 1.13|286928|33|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_015970 (Rhodothermus marinus SG0.5JP17-172 plasmid pRHOM17201, complete sequence) position: , mismatch: 8, identity: 0.758 

attgagcgcgatgtcgcaagcaaagcgttgatt	CRISPR spacer
cgtgagcgccatgtcgcacgcaaagcgcaaagt	Protospacer
  ******* ******** ********. .* *

29. spacer 1.16|287109|32|NZ_CP049756|CRISPRCasFinder,CRT matches to JX238501 (Bacillus phage phiAGATE, complete genome) position: , mismatch: 8, identity: 0.75 

cagaagaactgttcggtgaagggttttacacg	CRISPR spacer
tcgaagaacagttcgttgaagggtttagcagt	Protospacer
. ******* ***** ********** .**

30. spacer 1.30|287951|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048306 (Escherichia coli strain 9 plasmid p009_B, complete sequence) position: , mismatch: 8, identity: 0.75 

ttacgg-ggctacagccgtcgcccctcccgtca	CRISPR spacer
-ggcggttgctacagccgtcgctccttccgtat	Protospacer
  .***  **************.***.****

31. spacer 1.30|287951|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 8, identity: 0.75 

ttacgg-ggctacagccgtcgcccctcccgtca	CRISPR spacer
-ggcggttgctacagccgtcgctccttccgtat	Protospacer
  .***  **************.***.****

32. spacer 1.30|287951|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019027 (Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence) position: , mismatch: 8, identity: 0.75 

ttacgg-ggctacagccgtcgcccctcccgtca	CRISPR spacer
-ggcggttgctacagccgtcgctccttccgtat	Protospacer
  .***  **************.***.****

33. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to MN693287 (Marine virus AFVG_25M168, complete genome) position: , mismatch: 8, identity: 0.733 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
aatgagtgagtaccatattttttattgcag	Protospacer
.  ****.**.****************. .

34. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214999 (Mycoplasma conjunctivae strain NCTC10147 plasmid 3) position: , mismatch: 8, identity: 0.733 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
gtttctaaagaaccatattttttcttgtta	Protospacer
*.     *** ************ ******

35. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to LR214965 (Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 11) position: , mismatch: 8, identity: 0.733 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
gtttctaaagaaccatattttttcttgtta	Protospacer
*.     *** ************ ******

36. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041255 (Enterococcus faecium strain 515 plasmid p32, complete sequence) position: , mismatch: 8, identity: 0.733 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
ataaggaaagcactatattttttattgtct	Protospacer
..*..* ******.**************.

37. spacer 2.5|1056513|30|NZ_CP049756|PILER-CR,CRISPRCasFinder,CRT matches to CP040041 (Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

gcagagtaagcaccatattttttattgtta	CRISPR spacer
tttgaaaaagcaccatattttttaatgtgc	Protospacer
 . **. ***************** ***

38. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KX346250 (Lactococcus phage MW18S, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

39. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KP793114 (Lactococcus phage 936 group phage Phi17, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

40. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_049361 (Lactococcus phage 936 group phage PhiL.6, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

41. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_049367 (Lactococcus phage 936 group phage PhiE1127, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

42. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KX379672 (Lactococcus phage 16W12L, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

43. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_049434 (Lactococcus phage MP1, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

44. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KX379673 (Lactococcus phage MW18L, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

45. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_049373 (Lactococcus phage 16W23, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

46. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KP793132 (Lactococcus phage 936 group phage PhiM1127, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

47. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KP793135 (Lactococcus phage 936 group phage Phi.16, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

48. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KX346242 (Lactococcus phage 8R06S, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

49. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KP793128 (Lactococcus phage 936 group phage PhiM.16, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

50. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KP793126 (Lactococcus phage 936 group phage PhiM.5, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

51. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KM091443 (Lactococcus phage phi93, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

52. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_049366 (Lactococcus phage 936 group phage Phi155, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

53. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KP793127 (Lactococcus phage 936 group phage Phi40, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

54. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MK301441 (Lactococcus phage MV16, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

55. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KP793121 (Lactococcus phage 936 group phage Phi109, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

56. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KP793125 (Lactococcus phage 936 group phage Phi91127, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

57. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_049446 (Lactococcus phage 8V08, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

58. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KM091444 (Lactococcus phage phi145, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

59. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_049447 (Lactococcus phage MV10L, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

60. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to KP793120 (Lactococcus phage 936 group phage PhiL.18, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

61. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KX346250 (Lactococcus phage MW18S, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

62. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KP793114 (Lactococcus phage 936 group phage Phi17, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

63. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to NC_049361 (Lactococcus phage 936 group phage PhiL.6, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

64. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to NC_049367 (Lactococcus phage 936 group phage PhiE1127, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

65. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KX379672 (Lactococcus phage 16W12L, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

66. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to NC_049434 (Lactococcus phage MP1, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

67. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KX379673 (Lactococcus phage MW18L, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

68. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to NC_049373 (Lactococcus phage 16W23, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

69. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KP793132 (Lactococcus phage 936 group phage PhiM1127, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

70. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KP793135 (Lactococcus phage 936 group phage Phi.16, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

71. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KX346242 (Lactococcus phage 8R06S, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

72. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KP793128 (Lactococcus phage 936 group phage PhiM.16, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

73. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KP793126 (Lactococcus phage 936 group phage PhiM.5, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

74. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KM091443 (Lactococcus phage phi93, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

75. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to NC_049366 (Lactococcus phage 936 group phage Phi155, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

76. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KP793127 (Lactococcus phage 936 group phage Phi40, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

77. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to MK301441 (Lactococcus phage MV16, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

78. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KP793121 (Lactococcus phage 936 group phage Phi109, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

79. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KP793125 (Lactococcus phage 936 group phage Phi91127, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

80. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to NC_049446 (Lactococcus phage 8V08, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

81. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KM091444 (Lactococcus phage phi145, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

82. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to NC_049447 (Lactococcus phage MV10L, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

83. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to KP793120 (Lactococcus phage 936 group phage PhiL.18, complete genome) position: , mismatch: 8, identity: 0.75 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
atagaaataaaggaggactaacaaatggtagt	Protospacer
**   **.** ***************** *.

84. spacer 5.5|2107550|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to LT960552 (Yersinia phage fHe-Yen9-03 genome assembly, complete genome: monopartite) position: , mismatch: 8, identity: 0.75 

gaccgcttaacgttcgatgaacgcattcaagc	CRISPR spacer
aatccgttcacgttcgatgaacgcaatcaggt	Protospacer
.*.*  ** **************** ***.*.

85. spacer 5.5|2107550|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to LR596615 (Yersinia phage fHe-Yen9-04 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.75 

gaccgcttaacgttcgatgaacgcattcaagc	CRISPR spacer
aatccgttcacgttcgatgaacgcaatcaggt	Protospacer
.*.*  ** **************** ***.*.

86. spacer 5.5|2107550|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to NC_042116 (Yersinia phage fHe-Yen9-04 genome assembly, complete genome: monopartite) position: , mismatch: 8, identity: 0.75 

gaccgcttaacgttcgatgaacgcattcaagc	CRISPR spacer
aatccgttcacgttcgatgaacgcaatcaggt	Protospacer
.*.*  ** **************** ***.*.

87. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

88. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_018265 (Melissococcus plutonius DAT561 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
tgttaacatatttaatagataaattattgaat	Protospacer
 *.** ******** ***********. .  *

89. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

90. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP006684 (Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
tgttaacatatttaatagataaattattgaat	Protospacer
 *.** ******** ***********. .  *

91. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_AP021886 (Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
tgttaacatatttaatagataaattattgaat	Protospacer
 *.** ******** ***********. .  *

92. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

93. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

94. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

95. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

96. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

97. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

98. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

99. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

100. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

101. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

102. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

103. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

104. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

105. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

106. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

107. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

108. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

109. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

110. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

111. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

112. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

113. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

114. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

115. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

116. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

117. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

118. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

119. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

120. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

121. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

122. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

123. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

124. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

125. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

126. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

127. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

128. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

129. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

130. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

131. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

132. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

133. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

134. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

135. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

136. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

137. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaattttttcat	Protospacer
* ***************.** **** .  . *

138. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_AP018525 (Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
tgttaacatatttaatagataaattattgaat	Protospacer
 *.** ******** ***********. .  *

139. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

140. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

141. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

142. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

143. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

144. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

145. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

146. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

147. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

148. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

149. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

150. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

151. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

152. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

153. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 9, identity: 0.719 

agctatcatatttattagataaattacaattt	CRISPR spacer
acctatcatatttattaaatcaatttttttca	Protospacer
* ***************.** **** .  *.

154. spacer 1.8|286628|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP007001 (Campylobacter fetus subsp. venerealis cfvi03/293 plasmid pCfviMP2, complete sequence) position: , mismatch: 9, identity: 0.719 

ttgaaatttgcggtaactggatttggttaagt	CRISPR spacer
caccattatgaggtaactggatttggtgaagc	Protospacer
.   * * ** **************** ***.

155. spacer 1.9|286688|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MG592429 (Vibrio phage 1.047.O._10N.286.55.F2, partial genome) position: , mismatch: 9, identity: 0.719 

ttcatcatctacaacctttagccctactgata	CRISPR spacer
agtagcctctacaacctttagccctggtgacg	Protospacer
  .* * ******************. ***..

156. spacer 1.10|286748|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MN692994 (Marine virus AFVG_117M61, complete genome) position: , mismatch: 9, identity: 0.719 

aaaactatcaacgatagctggaactgtaaaac	CRISPR spacer
tgaccacccaacgatagctggaactttcaaaa	Protospacer
 .* *  .***************** * ***

157. spacer 1.10|286748|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MN692961 (Marine virus AFVG_117M41, complete genome) position: , mismatch: 9, identity: 0.719 

aaaactatcaacgatagctggaactgtaaaac	CRISPR spacer
tgaccacccaacgatagctggaactttcaaaa	Protospacer
 .* *  .***************** * ***

158. spacer 1.10|286748|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MN693032 (Marine virus AFVG_117M42, complete genome) position: , mismatch: 9, identity: 0.719 

aaaactatcaacgatagctggaactgtaaaac	CRISPR spacer
tgaccacccaacgatagctggaactttcaaaa	Protospacer
 .* *  .***************** * ***

159. spacer 1.18|287229|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_012855 (Ralstonia pickettii 12D plasmid pRp12D01, complete sequence) position: , mismatch: 9, identity: 0.719 

ttgtcgtactctgtcagcttcagcctgtaatc	CRISPR spacer
ttgtcgttctttgtcagcttcagctctcgttg	Protospacer
******* **.*************.. .. *

160. spacer 3.11|1631007|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MK448711 (Streptococcus phage Javan235, complete genome) position: , mismatch: 9, identity: 0.719 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
ctgaagaaaatggaggacaaacaaatgaaaat	Protospacer
 *   .* ********** ********.***

161. spacer 3.23|1631008|32|NZ_CP049756|PILER-CR matches to MK448711 (Streptococcus phage Javan235, complete genome) position: , mismatch: 9, identity: 0.719 

attttaacaatggaggactaacaaatggaaaa	CRISPR spacer
ctgaagaaaatggaggacaaacaaatgaaaat	Protospacer
 *   .* ********** ********.***

162. spacer 5.4|2107490|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to MN657092 (Psychrobacter sp. strain ANT_P40 plasmid pA40P3, complete sequence) position: , mismatch: 9, identity: 0.719 

cgatatcgtcgatatgaatatcgctttttccc	CRISPR spacer
aaaaatcatcgatattaatatcgcttttatta	Protospacer
 .* ***.******* ************ ..

163. spacer 5.4|2107490|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719 

cgatatcgtcgatatgaatatcgctttttccc	CRISPR spacer
cgatatcgtcggtattaatatcgttgagccga	Protospacer
***********.*** *******.*   .*

164. spacer 5.6|2107610|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 9, identity: 0.719 

ttatcaatgatgctttccaagtagataaagaa	CRISPR spacer
tagataatgatgattttcaagtagataaaatt	Protospacer
* . .******* ***.************.

165. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 10, identity: 0.688 

agctatcatatttattagataaattacaattt	CRISPR spacer
tggtatcatatatcttagataaattaggtaga	Protospacer
 * ******** * ************ .

166. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP014203 (Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence) position: , mismatch: 10, identity: 0.688 

agctatcatatttattagataaattacaattt	CRISPR spacer
ctatatgatatttatttgataaattatcaaaa	Protospacer
   *** ********* *********. *

167. spacer 1.1|286208|32|NZ_CP049756|CRISPRCasFinder,CRT matches to MN693757 (Marine virus AFVG_250M21, complete genome) position: , mismatch: 10, identity: 0.688 

agctatcatatttattagataaattacaattt	CRISPR spacer
gcttatcatatttactagttaaattatcagca	Protospacer
. .***********.*** *******. * .

168. spacer 1.6|286508|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP024792 (Nostoc flagelliforme CCNUN1 plasmid pNFSY07, complete sequence) position: , mismatch: 10, identity: 0.688 

cttctggttgcagtctgcgctgcttttgttgc	CRISPR spacer
aggatggttgcagtctgcactactttttctat	Protospacer
    **************.**.***** .*..

169. spacer 1.21|287411|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 10, identity: 0.688 

tcttgcttagcttggttctctaacgcctcaaa	CRISPR spacer
cgttgcgtagcttgcttctctaacgttcgcga	Protospacer
. **** ******* **********...  .*

170. spacer 1.21|287411|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tcttgcttagcttggttctctaacgcctcaaa	CRISPR spacer
cgttgcgtagcttgcttctctaacgttcgcga	Protospacer
. **** ******* **********...  .*

171. spacer 1.22|287471|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 10, identity: 0.688 

tcttgcttagcttggttctctaacgcctcaaa	CRISPR spacer
cgttgcgtagcttgcttctctaacgttcgcga	Protospacer
. **** ******* **********...  .*

172. spacer 1.22|287471|32|NZ_CP049756|CRISPRCasFinder,CRT matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tcttgcttagcttggttctctaacgcctcaaa	CRISPR spacer
cgttgcgtagcttgcttctctaacgttcgcga	Protospacer
. **** ******* **********...  .*

173. spacer 1.25|287651|32|NZ_CP049756|CRISPRCasFinder,CRT,PILER-CR matches to MK448659 (Streptococcus satellite phage Javan89, complete genome) position: , mismatch: 10, identity: 0.688 

aacgcttagacataaccactaataaatcagtt	CRISPR spacer
cataacaagacataaccactcataactcagac	Protospacer
 *.. . ************* **** **** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 153791 : 181654 31 Pseudomonas_phage(57.69%) tail NA
DBSCAN-SWA_2 184974 : 193803 15 Burkholderia_phage(37.5%) transposase NA
DBSCAN-SWA_3 369098 : 377167 6 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_4 911320 : 927711 18 uncultured_Caudovirales_phage(55.56%) capsid,tRNA,terminase,portal,protease,tail,integrase,head attL 914301:914315|attR 933542:933556
DBSCAN-SWA_5 1066667 : 1093978 39 Mannheimia_phage(14.29%) holin,terminase,integrase attL 1064217:1064231|attR 1067886:1067900
DBSCAN-SWA_6 1678828 : 1712126 43 Haemophilus_phage(46.88%) capsid,plate,terminase,tail,integrase attL 1674613:1674628|attR 1717396:1717411

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage