Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049890 Jeotgalibaca porci strain CCUG 69148 plasmid p_unnamed1, complete sequence 0 crisprs csa3 0 0 1 0
NZ_CP049889 Jeotgalibaca porci strain CCUG 69148 chromosome, complete genome 2 crisprs csa3,RT,cas14j,DinG,DEDDh,cas3 0 1 150 0

Results visualization

1. NZ_CP049890
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1042 : 10257 12 Streptococcus_phage(28.57%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP049889
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049889_1 1699152-1699226 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049889_2 2208679-2208755 Orphan NA
1 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049889_2 2.1|2208704|27|NZ_CP049889|CRISPRCasFinder 2208704-2208730 27 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1156352-1156378 6 0.778

1. spacer 2.1|2208704|27|NZ_CP049889|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 6, identity: 0.778

ctaccgtctttcaggagggaatgaaaa	CRISPR spacer
cctccgtctttcaggagggattgaggc	Protospacer
*. ***************** ***.. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 33261 59 Streptococcus_phage(33.33%) portal,capsid,head,tail,terminase,holin NA
DBSCAN-SWA_2 37563 : 38295 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_3 44565 : 44814 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_4 50544 : 62181 10 uncultured_Mediterranean_phage(20.0%) tRNA NA
DBSCAN-SWA_5 71072 : 76221 5 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_6 80501 : 82056 2 Flavobacterium_phage(50.0%) NA NA
DBSCAN-SWA_7 90294 : 92532 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_8 96607 : 107970 10 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_9 111008 : 111632 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_10 116591 : 125201 9 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_11 129142 : 133112 4 Clostridium_phage(50.0%) integrase attL 128245:128257|attR 130669:130681
DBSCAN-SWA_12 141473 : 142103 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_13 146225 : 149769 4 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_14 154658 : 166363 14 Clostridium_phage(20.0%) integrase,holin attL 147929:147943|attR 170622:170636
DBSCAN-SWA_15 172697 : 192071 15 Bacillus_virus(25.0%) protease NA
DBSCAN-SWA_16 195337 : 198689 3 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_17 202814 : 213956 7 Staphylococcus_phage(50.0%) tRNA,transposase NA
DBSCAN-SWA_18 221364 : 229489 8 Only_Syngen_Nebraska_virus(25.0%) NA NA
DBSCAN-SWA_19 235584 : 246903 10 Streptococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_20 251871 : 252966 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_21 259421 : 259799 1 Microbacterium_phage(100.0%) NA NA
DBSCAN-SWA_22 277312 : 288688 14 Lake_Baikal_phage(12.5%) NA NA
DBSCAN-SWA_23 298572 : 299229 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_24 308922 : 320721 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_25 329649 : 338892 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_26 344974 : 345568 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_27 356644 : 361568 5 Aeromonas_phage(33.33%) NA NA
DBSCAN-SWA_28 365882 : 369418 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_29 386035 : 386731 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_30 390666 : 393147 3 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_31 402528 : 410984 7 Hokovirus(33.33%) tRNA NA
DBSCAN-SWA_32 436549 : 442141 5 Clostridium_botulinum_C_phage(25.0%) NA NA
DBSCAN-SWA_33 449701 : 451108 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_34 457112 : 461233 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_35 467312 : 476832 8 Catovirus(33.33%) tRNA NA
DBSCAN-SWA_36 480155 : 481292 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_37 484835 : 486104 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_38 490260 : 493050 4 Lactococcus_phage(50.0%) protease NA
DBSCAN-SWA_39 498570 : 504332 5 Lactococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_40 514228 : 522040 7 Lactobacillus_phage(25.0%) tRNA,transposase NA
DBSCAN-SWA_41 549682 : 557072 6 Paenibacillus_phage(33.33%) transposase NA
DBSCAN-SWA_42 563392 : 564337 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_43 567640 : 569452 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_44 581058 : 593980 12 Agrobacterium_phage(20.0%) tRNA NA
DBSCAN-SWA_45 602606 : 603879 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_46 610864 : 611221 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_47 615050 : 617354 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_48 636820 : 637492 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_49 647625 : 648432 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_50 651996 : 653358 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_51 664710 : 665361 1 Listeria_phage(100.0%) NA NA
DBSCAN-SWA_52 673300 : 688416 9 Oenococcus_phage(16.67%) NA NA
DBSCAN-SWA_53 692780 : 706707 13 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_54 748391 : 782039 42 Streptococcus_phage(18.18%) integrase,transposase attL 755377:755393|attR 766906:766922
DBSCAN-SWA_55 795316 : 798608 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_56 803898 : 804360 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_57 811053 : 811617 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_58 816463 : 823477 8 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_59 829646 : 831473 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_60 848217 : 862649 14 Erysipelothrix_phage(42.86%) NA NA
DBSCAN-SWA_61 871315 : 873889 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_62 880395 : 880608 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_63 888326 : 890018 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_64 896790 : 898890 2 Catovirus(50.0%) transposase NA
DBSCAN-SWA_65 904082 : 915081 10 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_66 922227 : 943237 18 Streptococcus_phage(46.15%) NA NA
DBSCAN-SWA_67 948765 : 953639 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_68 956728 : 961009 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_69 966750 : 976969 8 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_70 980266 : 989512 8 uncultured_virus(50.0%) transposase,protease NA
DBSCAN-SWA_71 995879 : 997325 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_72 1015336 : 1016197 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_73 1023129 : 1023996 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_74 1032606 : 1033362 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_75 1037283 : 1044374 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_76 1047913 : 1053269 6 Lactobacillus_phage(25.0%) transposase NA
DBSCAN-SWA_77 1057197 : 1058295 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_78 1065998 : 1067504 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_79 1092892 : 1105398 11 Bacillus_phage(28.57%) tRNA NA
DBSCAN-SWA_80 1108615 : 1109653 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_81 1114045 : 1123435 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_82 1137075 : 1139597 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_83 1160598 : 1162020 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_84 1167777 : 1168140 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_85 1171501 : 1177145 5 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_86 1193727 : 1202019 7 Aurantimonas_phage(25.0%) NA NA
DBSCAN-SWA_87 1205505 : 1206873 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_88 1217222 : 1305505 85 Bacillus_phage(14.29%) tRNA,transposase,protease NA
DBSCAN-SWA_89 1308649 : 1319688 12 Streptococcus_phage(28.57%) NA NA
DBSCAN-SWA_90 1323116 : 1323698 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_91 1328936 : 1330010 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_92 1333084 : 1337122 3 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_93 1350715 : 1352296 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_94 1356391 : 1360675 4 Feldmannia_species_virus(33.33%) NA NA
DBSCAN-SWA_95 1366529 : 1369089 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_96 1375216 : 1377428 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_97 1401785 : 1465290 60 Bacillus_phage(38.89%) transposase NA
DBSCAN-SWA_98 1470225 : 1473056 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_99 1478965 : 1479334 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_100 1485723 : 1486494 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_101 1492415 : 1499256 7 Phage_TP(25.0%) NA NA
DBSCAN-SWA_102 1504878 : 1514602 6 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_103 1522943 : 1528478 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_104 1536772 : 1541838 4 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_105 1548648 : 1552159 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_106 1566928 : 1575357 6 Anomala_cuprea_entomopoxvirus(25.0%) NA NA
DBSCAN-SWA_107 1581886 : 1583987 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_108 1589893 : 1600775 9 Staphylococcus_phage(40.0%) transposase NA
DBSCAN-SWA_109 1614833 : 1620933 4 Cronobacter_phage(33.33%) tRNA NA
DBSCAN-SWA_110 1624760 : 1626074 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_111 1629222 : 1629990 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_112 1633167 : 1638285 5 Bacillus_virus(25.0%) NA NA
DBSCAN-SWA_113 1648922 : 1660133 10 Hokovirus(28.57%) tRNA NA
DBSCAN-SWA_114 1680964 : 1682655 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_115 1691660 : 1693817 2 Paenibacillus_phage(50.0%) transposase NA
DBSCAN-SWA_116 1697546 : 1699067 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_117 1710503 : 1711541 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_118 1720469 : 1722161 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_119 1738146 : 1739166 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_120 1745341 : 1752626 6 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_121 1762566 : 1763601 1 Staphylococcus_virus(100.0%) NA NA
DBSCAN-SWA_122 1783466 : 1796489 11 Vibrio_phage(16.67%) NA NA
DBSCAN-SWA_123 1806215 : 1813789 8 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_124 1862734 : 1866457 3 Enterococcus_phage(66.67%) NA NA
DBSCAN-SWA_125 1877179 : 1880340 3 Paenibacillus_phage(50.0%) transposase NA
DBSCAN-SWA_126 1890286 : 1891009 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_127 1896438 : 1974292 67 Bacillus_phage(27.27%) tRNA,transposase NA
DBSCAN-SWA_128 1978872 : 1980918 2 Geobacillus_virus(50.0%) NA NA
DBSCAN-SWA_129 1989120 : 2019660 32 Streptococcus_phage(69.57%) integrase attL 1985611:1985624|attR 1999896:1999909
DBSCAN-SWA_130 2030736 : 2033531 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_131 2041262 : 2044028 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_132 2051951 : 2054084 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_133 2057404 : 2064226 4 Streptococcus_phage(75.0%) integrase,transposase attL 2060050:2060066|attR 2069920:2069936
DBSCAN-SWA_134 2074819 : 2076871 3 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_135 2082585 : 2083305 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_136 2086640 : 2092029 3 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_137 2095330 : 2097680 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_138 2116340 : 2118758 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_139 2124618 : 2125764 1 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_140 2137677 : 2142209 4 Cyanophage(33.33%) NA NA
DBSCAN-SWA_141 2152331 : 2168306 13 Bacillus_phage(28.57%) NA NA
DBSCAN-SWA_142 2172022 : 2173063 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_143 2176134 : 2182812 5 Catovirus(33.33%) NA NA
DBSCAN-SWA_144 2192058 : 2204569 14 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_145 2208304 : 2231233 18 Bacillus_virus(22.22%) tRNA,protease NA
DBSCAN-SWA_146 2239726 : 2245945 4 Chrysochromulina_ericina_virus(33.33%) NA NA
DBSCAN-SWA_147 2250449 : 2254962 5 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_148 2258548 : 2263876 6 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_149 2284737 : 2291383 7 Enterococcus_phage(25.0%) NA NA
DBSCAN-SWA_150 2295684 : 2297508 2 Listeria_phage(50.0%) integrase attL 2293484:2293496|attR 2297772:2297784
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage