Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049865 Propioniciclava sp. HDW11 chromosome, complete genome 4 crisprs DEDDh,csa3,cas3,WYL,RT,DinG 1 1 1 0

Results visualization

1. NZ_CP049865
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049865_1 260732-260830 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049865_2 672580-672674 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049865_3 1876946-1877051 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049865_4 3481947-3482104 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP049865_2 2.1|672613|29|NZ_CP049865|CRISPRCasFinder 672613-672641 29 NZ_CP049865.1 672761-672789 2 0.931

1. spacer 2.1|672613|29|NZ_CP049865|CRISPRCasFinder matches to position: 672761-672789, mismatch: 2, identity: 0.931

cgcaccgacccagccgccactccacggga	CRISPR spacer
cgcacccacccagccgccagtccacggga	Protospacer
****** ************ *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049865_2 2.1|672613|29|NZ_CP049865|CRISPRCasFinder 672613-672641 29 NC_014214 Meiothermus silvanus DSM 9946 plasmid pMESIL02, complete sequence 12547-12575 7 0.759

1. spacer 2.1|672613|29|NZ_CP049865|CRISPRCasFinder matches to NC_014214 (Meiothermus silvanus DSM 9946 plasmid pMESIL02, complete sequence) position: , mismatch: 7, identity: 0.759

cgcaccgacccagccgccactccacggga	CRISPR spacer
ccaaccgacccagccgccgctccaccttg	Protospacer
*  ***************.******   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1669821 : 1709527 20 Mycobacterium_phage(44.44%) integrase,transposase attL 1701135:1701156|attR 1709784:1709805
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage