Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP050065 Bradyrhizobium symbiodeficiens strain 141S2 chromosome, complete genome 2 crisprs csa3,WYL,DEDDh 0 2 3 0

Results visualization

1. NZ_CP050065
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050065_1 1981206-1981882 Orphan NA
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050065_2 1981989-1982061 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP022209 Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed1, complete sequence 156135-156166 6 0.812
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP009321 Burkholderia gladioli strain ATCC 10248 plasmid 1, complete sequence 180841-180872 6 0.812
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP022007 Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence 108207-108238 6 0.812
NZ_CP050065_1 1.2|1981288|32|NZ_CP050065|CRISPRCasFinder 1981288-1981319 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1781241-1781272 8 0.75
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013528 Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence 255164-255195 8 0.75
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013581 Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence 255167-255198 8 0.75
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP050095 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b1, complete sequence 199074-199105 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 535439-535470 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 259232-259263 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NC_008381 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence 409618-409649 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 523117-523148 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 639932-639963 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP021026 Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence 178880-178911 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013524 Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence 245660-245691 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 255610-255641 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 251597-251628 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 260433-260464 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013559 Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence 257119-257150 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013576 Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence 256890-256921 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013548 Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence 256888-256919 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013533 Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence 256888-256919 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013543 Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence 260300-260331 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 255610-255641 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 259416-259447 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013570 Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence 256890-256921 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 589962-589993 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 139704-139735 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 648376-648407 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 552161-552192 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 410722-410753 9 0.719
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 397291-397322 9 0.719
NZ_CP050065_1 1.2|1981288|32|NZ_CP050065|CRISPRCasFinder 1981288-1981319 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1117380-1117411 10 0.688
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 212946-212977 10 0.688
NZ_CP050065_1 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder 1981345-1981376 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 151996-152027 10 0.688

1. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP022209 (Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

cgaaccgctgaagcccaagacgccg--ttgttgg	CRISPR spacer
cgaatcgctgaagcccaagactccgtatcgtc--	Protospacer
****.**************** ***  *.**.  

2. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP009321 (Burkholderia gladioli strain ATCC 10248 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

cgaaccgctgaagcccaagacgccg--ttgttgg	CRISPR spacer
cgaatcgctgaagcccaagactccgtatcgtc--	Protospacer
****.**************** ***  *.**.  

3. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP022007 (Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence) position: , mismatch: 6, identity: 0.812

cgaaccgctgaagcccaagacgccg--ttgttgg	CRISPR spacer
cgaatcgctgaagcccaagactccgtatcgtc--	Protospacer
****.**************** ***  *.**.  

4. spacer 1.2|1981288|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcccgcgaacgacatcgcaaggttgttgg	CRISPR spacer
gatggccgcgaagggcatcgcaaggttggcga	Protospacer
*..* ******* *.************* .*.

5. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 8, identity: 0.75

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgttgccga	Protospacer
*    ******** **************..*.

6. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 8, identity: 0.75

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgttgccga	Protospacer
*    ******** **************..*.

7. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP050095 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b1, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccattgccga	Protospacer
*    ******** **********.***..*.

8. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
cttcgcgctgaagaccaagacgccattgccga	Protospacer
*    ******** **********.***..*.

9. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
cttcgcgctgaagaccaagacgccattgccga	Protospacer
*    ******** **********.***..*.

10. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccattgccga	Protospacer
*    ******** **********.***..*.

11. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
cttcgcgctgaagaccaagacgccattgccga	Protospacer
*    ******** **********.***..*.

12. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgctgccga	Protospacer
*    ******** ***********.**..*.

13. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgctgccga	Protospacer
*    ******** ***********.**..*.

14. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgctgccga	Protospacer
*    ******** ***********.**..*.

15. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgctgccga	Protospacer
*    ******** ***********.**..*.

16. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
cttcgcgctgaagaccaagacgccattgccga	Protospacer
*    ******** **********.***..*.

17. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgctgccga	Protospacer
*    ******** ***********.**..*.

18. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgctgccga	Protospacer
*    ******** ***********.**..*.

19. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagtccaagacgccgctgccga	Protospacer
*    ********.***********.**..*.

20. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagtccaagacgccgctgccga	Protospacer
*    ********.***********.**..*.

21. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagtccaagacgccgctgccga	Protospacer
*    ********.***********.**..*.

22. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagtccaagacgccgctgccga	Protospacer
*    ********.***********.**..*.

23. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgctgccga	Protospacer
*    ******** ***********.**..*.

24. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
cttcgcgctgaagaccaagacgccattgccga	Protospacer
*    ******** **********.***..*.

25. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagtccaagacgccgctgccga	Protospacer
*    ********.***********.**..*.

26. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgctgccga	Protospacer
*    ******** ***********.**..*.

27. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
cttcgcgctgaagaccaagacgccattgccga	Protospacer
*    ******** **********.***..*.

28. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgctgccga	Protospacer
*    ******** ***********.**..*.

29. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
cttcgcgctgaagaccaagacgccattgccga	Protospacer
*    ******** **********.***..*.

30. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ctttgcgctgaagaccaagacgccgctgccga	Protospacer
*    ******** ***********.**..*.

31. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
cttcgcgctgaagaccaagacgccattgccga	Protospacer
*    ******** **********.***..*.

32. spacer 1.2|1981288|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgcccgcgaacgacatcgcaaggttgttgg	CRISPR spacer
tgcgcccgcgaacggcttcgcaagacgcagag	Protospacer
 *************.* *******..    .*

33. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 10, identity: 0.688

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ttttgcgctgaagaccaagacgccgctgccga	Protospacer
.    ******** ***********.**..*.

34. spacer 1.3|1981345|32|NZ_CP050065|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 10, identity: 0.688

cgaaccgctgaagcccaagacgccgttgttgg	CRISPR spacer
ttttgcgctgaagtccaagacgccattgccga	Protospacer
.    ********.**********.***..*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1342729 : 1352118 9 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_2 2851802 : 2861823 12 uncultured_Mediterranean_phage(88.89%) tRNA NA
DBSCAN-SWA_3 6027983 : 6036843 7 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage