Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP050152 Brevibacterium sp. WO024 chromosome, complete genome 4 crisprs WYL,PrimPol,casR,csa3,cas3,DEDDh,cas4,DinG 0 2 0 0

Results visualization

1. NZ_CP050152
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050152_1 2653545-2653645 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050152_2 3280530-3280611 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050152_3 3567022-3567110 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050152_4 3818702-3818796 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050152_3 3.1|3567054|25|NZ_CP050152|CRISPRCasFinder 3567054-3567078 25 CP016641 Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence 39090-39114 3 0.88
NZ_CP050152_3 3.1|3567054|25|NZ_CP050152|CRISPRCasFinder 3567054-3567078 25 NZ_CP014526 Haematospirillum jordaniae strain H5569 plasmid unnamed 1, complete sequence 9263-9287 4 0.84
NZ_CP050152_2 2.1|3280555|32|NZ_CP050152|CRISPRCasFinder 3280555-3280586 32 NC_008697 Nocardioides sp. JS614 plasmid pNOCA01, complete sequence 48113-48144 9 0.719

1. spacer 3.1|3567054|25|NZ_CP050152|CRISPRCasFinder matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 3, identity: 0.88

gtcggcaggggtgctcccgccttcg	CRISPR spacer
gtcggcagggatgctgccgcctttg	Protospacer
**********.**** *******.*

2. spacer 3.1|3567054|25|NZ_CP050152|CRISPRCasFinder matches to NZ_CP014526 (Haematospirillum jordaniae strain H5569 plasmid unnamed 1, complete sequence) position: , mismatch: 4, identity: 0.84

gtcggcaggggtgctcccgccttcg	CRISPR spacer
atcggcagggatgctcacgccttct	Protospacer
.*********.***** ******* 

3. spacer 2.1|3280555|32|NZ_CP050152|CRISPRCasFinder matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 9, identity: 0.719

atgtcggccgtcccggatacgggctcagcgtc	CRISPR spacer
ctgccggccgtcctggatacgggccatgcccg	Protospacer
 **.*********.**********.  ** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage