Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP050253 Orbus sp. IPMB12 chromosome, complete genome 3 crisprs DinG,DEDDh,cas3,csa3,WYL 0 3 1 0
NZ_CP050254 Orbus sp. IPMB12 plasmid pIPMB12, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP050253
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050253_1 1207801-1207891 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050253_2 1283483-1283692 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050253_3 1878517-1878603 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050253_2 2.1|1283516|27|NZ_CP050253|PILER-CR 1283516-1283542 27 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 40026-40052 5 0.815
NZ_CP050253_2 2.2|1283576|27|NZ_CP050253|PILER-CR 1283576-1283602 27 NZ_CP015353 Bacillus thuringiensis strain MYBT18246 plasmid p120510, complete sequence 36951-36977 6 0.778
NZ_CP050253_2 2.5|1283633|32|NZ_CP050253|CRISPRCasFinder,CRT 1283633-1283664 32 MT774383 CrAssphage cr11_1, complete genome 11288-11319 8 0.75
NZ_CP050253_2 2.5|1283633|32|NZ_CP050253|CRISPRCasFinder,CRT 1283633-1283664 32 NZ_LR215011 Mycoplasma canis strain NCTC10146 plasmid 2 1055-1086 8 0.75
NZ_CP050253_2 2.5|1283633|32|NZ_CP050253|CRISPRCasFinder,CRT 1283633-1283664 32 NZ_LR215011 Mycoplasma canis strain NCTC10146 plasmid 2 6527-6558 8 0.75
NZ_CP050253_2 2.5|1283633|32|NZ_CP050253|CRISPRCasFinder,CRT 1283633-1283664 32 NC_019773 Anabaena cylindrica PCC 7122 plasmid pANACY.03, complete sequence 85446-85477 10 0.688

1. spacer 2.1|1283516|27|NZ_CP050253|PILER-CR matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.815

ctccaagagaggagaggacagggttta	CRISPR spacer
atccaagcgaggagaggacagggaatt	Protospacer
 ****** ***************  * 

2. spacer 2.2|1283576|27|NZ_CP050253|PILER-CR matches to NZ_CP015353 (Bacillus thuringiensis strain MYBT18246 plasmid p120510, complete sequence) position: , mismatch: 6, identity: 0.778

attaacaaggggaatgttacagcagct	CRISPR spacer
gctgacaaggggaatgttacagcaatg	Protospacer
..*.********************.. 

3. spacer 2.5|1283633|32|NZ_CP050253|CRISPRCasFinder,CRT matches to MT774383 (CrAssphage cr11_1, complete genome) position: , mismatch: 8, identity: 0.75

tataaaaaaaatattaatttcggaatttaata	CRISPR spacer
gataacaaaaatattaatatcggaactgatag	Protospacer
 **** ************ ******.* *  .

4. spacer 2.5|1283633|32|NZ_CP050253|CRISPRCasFinder,CRT matches to NZ_LR215011 (Mycoplasma canis strain NCTC10146 plasmid 2) position: , mismatch: 8, identity: 0.75

tataaaaaaaatattaatttcggaatttaata	CRISPR spacer
taaatttttaatattagttccggaatttaata	Protospacer
** *     *******.**.************

5. spacer 2.5|1283633|32|NZ_CP050253|CRISPRCasFinder,CRT matches to NZ_LR215011 (Mycoplasma canis strain NCTC10146 plasmid 2) position: , mismatch: 8, identity: 0.75

tataaaaaaaatattaatttcggaatttaata	CRISPR spacer
taaatttttaatattagttccggaatttaata	Protospacer
** *     *******.**.************

6. spacer 2.5|1283633|32|NZ_CP050253|CRISPRCasFinder,CRT matches to NC_019773 (Anabaena cylindrica PCC 7122 plasmid pANACY.03, complete sequence) position: , mismatch: 10, identity: 0.688

tataaaaaaaatattaatttcggaatttaata	CRISPR spacer
agcacaaaaaatatttatttgggaatttgtct	Protospacer
 ..* ********** **** *******. . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 972948 : 1011004 34 Enterobacteria_phage(27.78%) holin,integrase,tail attL 970200:970214|attR 985007:985021
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage