Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP022870 Phytohabitans flavus strain NBRC 107702 14 crisprs csa3,WYL,cas2,csm3gr7,cas10,csx10gr5,cas6,cas4,DEDDh,DinG,cas3 1 12 0 0

Results visualization

1. NZ_AP022870
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_1 677617-677714 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_2 677785-678292 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_3 1883688-1883807 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_4 2830868-2830962 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_5 4117859-4117971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_6 4252463-4252544 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_7 5047199-5047405 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_8 5089788-5089879 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_9 5177719-5178175 Orphan I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_10 6879192-6879288 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_11 7024275-7024361 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_12 7686817-7686910 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_13 9439666-9439769 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP022870_14 9445831-9445939 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP022870_2 2.3|677939|20|NZ_AP022870|CRISPRCasFinder 677939-677958 20 NZ_AP022870.1 2882223-2882242 2 0.9
NZ_AP022870_2 2.3|677939|20|NZ_AP022870|CRISPRCasFinder 677939-677958 20 NZ_AP022870.1 2398761-2398780 2 0.9

1. spacer 2.3|677939|20|NZ_AP022870|CRISPRCasFinder matches to position: 2882223-2882242, mismatch: 2, identity: 0.9 

cggcccagacgggcgaggcc	CRISPR spacer
cggcccagaccggcgcggcc	Protospacer
********** **** ****

2. spacer 2.3|677939|20|NZ_AP022870|CRISPRCasFinder matches to position: 2398761-2398780, mismatch: 2, identity: 0.9 

cggcccagacgggcgaggcc	CRISPR spacer
cggcccagaccggcgtggcc	Protospacer
********** **** ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NC_017805 Deinococcus gobiensis I-0 plasmid P1, complete sequence 172704-172735 4 0.875
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 595045-595073 4 0.862
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 862441-862472 5 0.844
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1031986-1032017 5 0.844
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1365848-1365879 5 0.844
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1365792-1365823 5 0.844
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 854180-854211 5 0.844
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 MN284893 Mycobacterium phage LilMcDreamy, complete genome 6032-6060 5 0.828
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 CP054934 Nocardiopsis flavescens strain NA01583 plasmid unnamed1, complete sequence 171245-171273 5 0.828
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 1223-1254 6 0.812
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 627241-627272 6 0.812
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 MG298964 Streptomyces phage Alsaber, complete genome 25900-25928 6 0.793
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 MT711979 Streptomyces phage Endor2, complete genome 25860-25888 6 0.793
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 MT701598 Streptomyces phage Sitrop, complete genome 23430-23458 6 0.793
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 MT711978 Streptomyces phage Endor1, complete genome 26315-26343 6 0.793
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 KT186229 Streptomyces phage Verse, complete genome 26727-26755 6 0.793
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 KX815338 Streptomyces phage Joe, complete genome 25628-25656 6 0.793
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 KT186228 Streptomyces phage Amela, complete genome 26733-26761 6 0.793
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 MN204498 Streptomyces phage Saftant, complete genome 26015-26043 6 0.793
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 NC_041856 Streptomyces phage phiCAM, complete genome 27862-27890 6 0.793
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 CP054924 Verrucosispora sp. NA02020 plasmid unnamed, complete sequence 58098-58129 6 0.812
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 364953-364984 6 0.812
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 76139-76170 6 0.812
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 216660-216691 6 0.812
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 364953-364985 6 0.818
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 CP054924 Verrucosispora sp. NA02020 plasmid unnamed, complete sequence 58097-58129 6 0.818
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 361788-361820 6 0.818
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 498681-498712 7 0.781
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 629782-629813 7 0.781
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 119221-119252 7 0.781
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 195042-195073 7 0.781
NZ_AP022870_2 2.4|677984|35|NZ_AP022870|CRISPRCasFinder 677984-678018 35 NC_019959 Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence 73031-73065 7 0.8
NZ_AP022870_2 2.4|677984|35|NZ_AP022870|CRISPRCasFinder 677984-678018 35 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 170997-171031 7 0.8
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 122055-122083 7 0.759
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 20404-20432 7 0.759
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 34123-34151 7 0.759
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 NC_023722 Rhodococcus phage ReqiPine5, complete genome 53691-53719 7 0.759
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 150428-150456 7 0.759
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 NC_004931 Streptomyces sp. EN27 plasmid pEN2701, complete sequence 9231-9259 7 0.759
NZ_AP022870_2 2.5|678044|29|NZ_AP022870|CRISPRCasFinder 678044-678072 29 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 154318-154346 7 0.759
NZ_AP022870_7 7.1|5047226|33|NZ_AP022870|CRISPRCasFinder 5047226-5047258 33 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 199371-199403 7 0.788
NZ_AP022870_7 7.3|5047346|33|NZ_AP022870|CRISPRCasFinder 5047346-5047378 33 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 110685-110717 7 0.788
NZ_AP022870_7 7.3|5047346|33|NZ_AP022870|CRISPRCasFinder 5047346-5047378 33 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 818539-818571 7 0.788
NZ_AP022870_7 7.3|5047346|33|NZ_AP022870|CRISPRCasFinder 5047346-5047378 33 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 229916-229948 7 0.788
NZ_AP022870_9 9.3|5177870|33|NZ_AP022870|CRISPRCasFinder 5177870-5177902 33 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 44057-44089 7 0.788
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 361788-361819 7 0.781
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 156150-156181 7 0.781
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 722940-722971 7 0.781
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2088578-2088609 7 0.781
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 635563-635594 7 0.781
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 281515-281546 7 0.781
NZ_AP022870_9 9.10|5177870|34|NZ_AP022870|CRT,PILER-CR 5177870-5177903 34 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 44057-44090 7 0.794
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 76139-76171 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 174985-175017 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 608874-608906 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 28640-28672 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_009467 Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence 133909-133941 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_009467 Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence 72448-72480 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 10069-10101 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_009469 Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence 43627-43659 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 319607-319639 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 210370-210402 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 635562-635594 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_020275 Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence 106999-107031 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 149460-149492 7 0.788
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 216660-216692 7 0.788
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1117262-1117293 8 0.75
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 405582-405613 8 0.75
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NC_008383 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL8, complete sequence 110184-110215 8 0.75
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP018231 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3 55187-55218 8 0.75
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP016292 Rhizobium leguminosarum strain Vaf10 plasmid unnamed4, complete sequence 132641-132672 8 0.75
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 103005-103036 8 0.75
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP050090 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b4, complete sequence 165493-165524 8 0.75
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 CP058906 Micromonospora phage pMLP1, complete sequence 23742-23773 8 0.75
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_LR134457 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence 50867-50898 8 0.75
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 44296-44327 8 0.75
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP021994 Cryobacterium sp. LW097 plasmid unnamed1 34340-34371 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 174985-175016 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 608874-608905 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 28641-28672 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1447542-1447573 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP015268 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence 7529-7560 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 73422-73453 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 319608-319639 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 19317-19348 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 304135-304166 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 344193-344224 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NC_012725 Burkholderia glumae BGR1 plasmid bglu_4p, complete sequence 29115-29146 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 43191-43222 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 66132-66163 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP035902 Burkholderia glumae strain 257sh-1 plasmid plas1, complete sequence 72259-72290 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 210371-210402 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1750200-1750231 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1766914-1766945 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 385395-385426 8 0.75
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 252125-252156 8 0.75
NZ_AP022870_9 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder 5178115-5178146 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 543394-543425 8 0.75
NZ_AP022870_9 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder 5178115-5178146 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 610929-610960 8 0.75
NZ_AP022870_9 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder 5178115-5178146 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1014769-1014800 8 0.75
NZ_AP022870_9 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder 5178115-5178146 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 543395-543426 8 0.75
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 304135-304167 8 0.758
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 156150-156182 8 0.758
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 722939-722971 8 0.758
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2088577-2088609 8 0.758
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1750200-1750232 8 0.758
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1766914-1766946 8 0.758
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1730116-1730148 8 0.758
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1017183-1017214 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 913811-913842 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 429324-429355 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 985913-985944 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 912908-912939 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 913803-913834 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 913821-913852 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 913794-913825 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 105632-105663 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1017273-1017304 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1017269-1017300 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1017252-1017283 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 543479-543510 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 167018-167049 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1613486-1613517 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1396544-1396575 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 167018-167049 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1024218-1024249 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 108987-109018 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 939422-939453 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1379967-1379998 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1098484-1098515 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1533657-1533688 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 100792-100823 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1116489-1116520 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 779436-779467 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP010870 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence 111637-111668 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1017427-1017458 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 9845-9876 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1106235-1106266 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 74028-74059 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 390641-390672 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 133061-133092 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 821089-821120 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1029845-1029876 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 931916-931947 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1026546-1026577 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1142532-1142563 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 60781-60812 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 962831-962862 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 69014-69045 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 982252-982283 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1106224-1106255 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1142499-1142530 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1141328-1141359 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1116496-1116527 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 989987-990018 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1141341-1141372 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 638953-638984 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 990010-990041 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1141341-1141372 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 937753-937784 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1141330-1141361 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 990010-990041 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1029026-1029057 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1009700-1009731 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1057647-1057678 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1103803-1103834 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1141330-1141361 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 990010-990041 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1070086-1070117 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1142498-1142529 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 990010-990041 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 990010-990041 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1141341-1141372 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1141352-1141383 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1141330-1141361 9 0.719
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP024892 Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence 157590-157621 9 0.719
NZ_AP022870_2 2.4|677984|35|NZ_AP022870|CRISPRCasFinder 677984-678018 35 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 162252-162286 9 0.743
NZ_AP022870_7 7.1|5047226|33|NZ_AP022870|CRISPRCasFinder 5047226-5047258 33 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1340054-1340086 9 0.727
NZ_AP022870_7 7.1|5047226|33|NZ_AP022870|CRISPRCasFinder 5047226-5047258 33 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1344722-1344754 9 0.727
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 516692-516723 9 0.719
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 475806-475837 9 0.719
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 5228-5259 9 0.719
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 532170-532201 9 0.719
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 651241-651272 9 0.719
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 15194-15225 9 0.719
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_LR536452 Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 3 92716-92747 9 0.719
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3895994-3896025 9 0.719
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 296173-296204 9 0.719
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1293496-1293527 9 0.719
NZ_AP022870_9 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder 5178115-5178146 32 MN694668 Marine virus AFVG_250M472, complete genome 44750-44781 9 0.719
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 475806-475838 9 0.727
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP015268 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence 7529-7561 9 0.727
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 73421-73453 9 0.727
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3895993-3896025 9 0.727
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 532170-532202 9 0.727
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 15194-15226 9 0.727
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_LR536452 Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 3 92716-92748 9 0.727
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 385395-385427 9 0.727
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1293496-1293528 9 0.727
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 838875-838907 9 0.727
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 443527-443558 10 0.688
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 520944-520975 10 0.688
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1016800-1016831 10 0.688
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 93982-94013 10 0.688
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 918423-918454 10 0.688
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 918413-918444 10 0.688
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 137132-137163 10 0.688
NZ_AP022870_9 9.1|5177748|32|NZ_AP022870|CRISPRCasFinder 5177748-5177779 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 278440-278471 10 0.688
NZ_AP022870_9 9.3|5177870|33|NZ_AP022870|CRISPRCasFinder 5177870-5177902 33 KX620754 Propionibacterium phage G4, complete genome 18411-18443 10 0.697
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 153516-153547 10 0.688
NZ_AP022870_9 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder 5178054-5178085 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 16349-16380 10 0.688
NZ_AP022870_9 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder 5178115-5178146 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 2110-2141 10 0.688
NZ_AP022870_9 9.10|5177870|34|NZ_AP022870|CRT,PILER-CR 5177870-5177903 34 KX620754 Propionibacterium phage G4, complete genome 18410-18443 10 0.706
NZ_AP022870_9 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR 5178054-5178086 33 NC_012725 Burkholderia glumae BGR1 plasmid bglu_4p, complete sequence 29114-29146 10 0.697
NZ_AP022870_9 9.14|5178115|33|NZ_AP022870|CRT,PILER-CR 5178115-5178147 33 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 543394-543426 10 0.697
NZ_AP022870_9 9.14|5178115|33|NZ_AP022870|CRT,PILER-CR 5178115-5178147 33 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 610929-610961 10 0.697
NZ_AP022870_9 9.14|5178115|33|NZ_AP022870|CRT,PILER-CR 5178115-5178147 33 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1014768-1014800 10 0.697
NZ_AP022870_9 9.14|5178115|33|NZ_AP022870|CRT,PILER-CR 5178115-5178147 33 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 543395-543427 10 0.697
NZ_AP022870_2 2.1|677810|32|NZ_AP022870|CRISPRCasFinder 677810-677841 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 747078-747109 12 0.625

1. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 4, identity: 0.875 

-accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
gacagca-cgaccggcaggcccgcgcggctcag	Protospacer
 ** *** ******** ************.***

2. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 4, identity: 0.862 

-cggattcggcgggcctggcccggacgggc	CRISPR spacer
gccgact-ggcgggcctggcccggaccggc	Protospacer
 * **.* ****************** ***

3. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

accgcaccgaccggccggcccgcgc--ggcccag	CRISPR spacer
ctcgaaccgaccggccggcccgcgctgggccc--	Protospacer
 .** ********************  *****

4. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

accgcaccgaccggccggcccgcgc--ggcccag	CRISPR spacer
ctcgaaccgaccggccggcccgcgctgggccc--	Protospacer
 .** ********************  *****

5. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.844 

accgcaccgaccggccggcccgcgc--ggcccag	CRISPR spacer
ctcgaaccgaccggccggcccgcgctgggccc--	Protospacer
 .** ********************  *****

6. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

accgcaccgaccggccggcccgcgc--ggcccag	CRISPR spacer
ctcgaaccgaccggccggcccgcgctgggccc--	Protospacer
 .** ********************  *****

7. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.844 

accgcaccgaccggccggcccgcgc--ggcccag	CRISPR spacer
ctcgaaccgaccggccggcccgcgctgggccc--	Protospacer
 .** ********************  *****

8. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to MN284893 (Mycobacterium phage LilMcDreamy, complete genome) position: , mismatch: 5, identity: 0.828 

--cggattcggcgggcctggcccggacgggc	CRISPR spacer
acctggt--ggcgggcctgggccggacgggc	Protospacer
  * *.*  *********** **********

9. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to CP054934 (Nocardiopsis flavescens strain NA01583 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828 

-cggattcggcgggcctggcccggacgggc	CRISPR spacer
acgggcgc-gcgggcctggcccgggcgggc	Protospacer
 ***.. * ***************.*****

10. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

accgcaccgaccggccggcccgc-gcggcccag	CRISPR spacer
tccgcaccgaccggccgacccacggcggtccc-	Protospacer
 ****************.***.* ****.**

11. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812 

accgcaccgaccggccggcccgc-gcggcccag	CRISPR spacer
accgcatcgaccggcaggcccgcagcggcatg-	Protospacer
******.******** ******* ***** ..

12. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to MG298964 (Streptomyces phage Alsaber, complete genome) position: , mismatch: 6, identity: 0.793 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
cgagtacgacgggcctggcccggacggca	Protospacer
**..* **.******************

13. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to MT711979 (Streptomyces phage Endor2, complete genome) position: , mismatch: 6, identity: 0.793 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
cgagtacgacgggcctggcccggacggca	Protospacer
**..* **.******************

14. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.793 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
cgagtacgacgggcctggcccggacggca	Protospacer
**..* **.******************

15. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to MT711978 (Streptomyces phage Endor1, complete genome) position: , mismatch: 6, identity: 0.793 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
cgagtacgacgggcctggcccggacggca	Protospacer
**..* **.******************

16. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to KT186229 (Streptomyces phage Verse, complete genome) position: , mismatch: 6, identity: 0.793 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
cgagtacgacgggcctggcccggacggca	Protospacer
**..* **.******************

17. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to KX815338 (Streptomyces phage Joe, complete genome) position: , mismatch: 6, identity: 0.793 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
cgagtacgacgggcctggcccggacggca	Protospacer
**..* **.******************

18. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to KT186228 (Streptomyces phage Amela, complete genome) position: , mismatch: 6, identity: 0.793 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
cgagtacgacgggcctggcccggacggca	Protospacer
**..* **.******************

19. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 6, identity: 0.793 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
cgagtacgacgggcctggcccggacggca	Protospacer
**..* **.******************

20. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to NC_041856 (Streptomyces phage phiCAM, complete genome) position: , mismatch: 6, identity: 0.793 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
cgagtacgacgggcctggcccggacggca	Protospacer
**..* **.******************

21. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to CP054924 (Verrucosispora sp. NA02020 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
ccgctgctggtcggcctcatcgccgccggcct	Protospacer
. *****.* ******************** .

22. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.812 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
cttccgccgctcaccctcatcgccgccggcgc	Protospacer
.  *.*******. ******************

23. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 6, identity: 0.812 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gaggtgccgctcgtcctcatcggcgccggcgg	Protospacer
 .* ********* ******** ********

24. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 6, identity: 0.812 

-tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gtggacg-cgctcggcctgatcgccgcccgcgt	Protospacer
 *** .* ********** ********* ***.

25. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.818 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
cttccgccgctcaccctcatcgccgccggcgcc	Protospacer
.  *.*******. *******************

26. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to CP054924 (Verrucosispora sp. NA02020 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
ccgctgctggtcggcctcatcgccgccggcctc	Protospacer
. *****.* ******************** .*

27. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.818 

tggctgccgctcggcctcatcgccg----ccggcgcc	CRISPR spacer
tggctgccgctcggcatcatcgcggcgatccgg----	Protospacer
*************** ******* *    ****

28. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
gccgcaccgaccggccggcgcgcgtgtcggtg	Protospacer
.****************** ****.* *   *

29. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781 

accgcaccgaccggccggcccg----cgcggcccag	CRISPR spacer
accgcatcgaccgtccggcccgccgacgaggc----	Protospacer
******.****** ********    ** ***

30. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 7, identity: 0.781 

accgc-accgaccggccggcccgcgcggcccag	CRISPR spacer
-ccgctcccgcccggccggcccgcgccgccgcc	Protospacer
 ****  *** *************** ***

31. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 7, identity: 0.781 

accgc-accgaccggccggcccgcgcggcccag	CRISPR spacer
-ccacgaccggcaggccggcccgcgcggcggcg	Protospacer
 **.* ****.* ****************   *

32. spacer 2.4|677984|35|NZ_AP022870|CRISPRCasFinder matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 7, identity: 0.8 

cggcgccggcggcctcggcccagaggggcgcgggt	CRISPR spacer
gcgggccggcggcctcggcccagacgggtgcggcg	Protospacer
  * ******************** ***.****

33. spacer 2.4|677984|35|NZ_AP022870|CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.8 

cggcgccggcggcctcggcccagaggggcgcgggt-	CRISPR spacer
ccgcgccgtcggcgtcggcccaga-gggcgaggacg	Protospacer
* ****** **** ********** ***** **..

34. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
tgtgggcggcggccctggcctggacgggc	Protospacer
.* .  ****** *******.********

35. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 7, identity: 0.759 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
tggattctgcgtgcctggcccggatgctg	Protospacer
.****** *** ************.*

36. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 7, identity: 0.759 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
tggattctgcgtgcctggcccggatgccg	Protospacer
.****** *** ************.*

37. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to NC_023722 (Rhodococcus phage ReqiPine5, complete genome) position: , mismatch: 7, identity: 0.759 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
acggctcggcgggcgtggccgggacgggg	Protospacer
  *..********* ***** *******

38. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 7, identity: 0.759 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
tggattctgcgtgcctggcccggatgccg	Protospacer
.****** *** ************.*

39. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to NC_004931 (Streptomyces sp. EN27 plasmid pEN2701, complete sequence) position: , mismatch: 7, identity: 0.759 

---cggattcggcgggcctggcccggacgggc	CRISPR spacer
gcctgg---cggcgggcctggccccgacggag	Protospacer
   .**   *************** *****.

40. spacer 2.5|678044|29|NZ_AP022870|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759 

cggattcggcgggcctggcccggacgggc	CRISPR spacer
tggattctgcgtgcctggcccggatgccg	Protospacer
.****** *** ************.*

41. spacer 7.1|5047226|33|NZ_AP022870|CRISPRCasFinder matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 7, identity: 0.788 

ggctgcccaacacccgccgccgcagtctcggtg	CRISPR spacer
ggcaggccaacacccgccgccgcacccgaggcg	Protospacer
*** * ****************** .*  **.*

42. spacer 7.3|5047346|33|NZ_AP022870|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788 

ggcgggatcgatgtcctcggccacgctcacacg---	CRISPR spacer
ggcgggatcgatatcctcggcgacg---acataggc	Protospacer
************.******** ***   ***..

43. spacer 7.3|5047346|33|NZ_AP022870|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.788 

ggcgggatcgatgtcctcggccacgctcacacg	CRISPR spacer
gccgaaatcgatgtcgtcggccacggtcacgag	Protospacer
* **..********* ********* ****. *

44. spacer 7.3|5047346|33|NZ_AP022870|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.788 

ggcgggatcgatgtcctcggccacgctcacacg	CRISPR spacer
gccgaaatcgatgtcgtcggccacggtcacgag	Protospacer
* **..********* ********* ****. *

45. spacer 9.3|5177870|33|NZ_AP022870|CRISPRCasFinder matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.788 

ggcggtgtcgtcttcgggcggtggcggcacggc-	CRISPR spacer
cacggtgtcgttttcggacggtggc-gcccagcg	Protospacer
 .*********.*****.******* ** *.**

46. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
tggctgccgctcggcatcatcgcggcgatccg	Protospacer
*************** ******* ** . *

47. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 7, identity: 0.781 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
ggcctgccgctcggcgtcctcgccgcctcctc	Protospacer
 * ************ ** ********  * *

48. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
tgggccatgctcggcctgatggccgccggcgc	Protospacer
*** .  .********* ** ***********

49. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.781 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
tgggccatgctcggcctgatggccgccggcgc	Protospacer
*** .  .********* ** ***********

50. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.781 

tggctgc--cgctcggcctcatcgccgccggcgc	CRISPR spacer
--gccgtagtgctcggcctcagcgcagccggcgc	Protospacer
  **.*.  .*********** *** ********

51. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 7, identity: 0.781 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
ggcctgccgctcggcgtcctcgccgcctcctc	Protospacer
 * ************ ** ********  * *

52. spacer 9.10|5177870|34|NZ_AP022870|CRT,PILER-CR matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794 

ggcggtgtcgtcttcgggcggtggcggcacggcg-	CRISPR spacer
cacggtgtcgttttcggacggtggc-gcccagcgc	Protospacer
 .*********.*****.******* ** *.***

53. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 7, identity: 0.788 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
gaggtgccgctcgtcctcatcggcgccggcggg	Protospacer
 .* ********* ******** ********

54. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.788 

tggctgccgctcggcctcatcgccg----ccggcgcc	CRISPR spacer
gggctgccgctcggcgtcatcgcggcgatccgg----	Protospacer
 ************** ******* *    ****

55. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.788 

tggctgccgctcggcctcatcgccg----ccggcgcc	CRISPR spacer
gggctgccgctcggcgtcatcgcggcgatccgg----	Protospacer
 ************** ******* *    ****

56. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.788 

tggctgccgctcggcctcatcgccg----ccggcgcc	CRISPR spacer
gggctgccgctcggcgtcatcgcggcgatccgg----	Protospacer
 ************** ******* *    ****

57. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_009467 (Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence) position: , mismatch: 7, identity: 0.788 

-tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
atgaacg-agctcggcatcatcgtcgccggcgcc	Protospacer
 **. .*  ******* ******.**********

58. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_009467 (Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence) position: , mismatch: 7, identity: 0.788 

-tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
atgaacg-agctcggcatcatcgtcgccggcgcc	Protospacer
 **. .*  ******* ******.**********

59. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 7, identity: 0.788 

-tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
atgaacg-agctcggcatcatcgtcgccggcgcc	Protospacer
 **. .*  ******* ******.**********

60. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 7, identity: 0.788 

-tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
atgaacg-agctcggcatcatcgtcgccggcgcc	Protospacer
 **. .*  ******* ******.**********

61. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.788 

tggctgccgctcggcctcatcgccg----ccggcgcc	CRISPR spacer
gggctgccgctcggcatcatcgcggcgatccgg----	Protospacer
 ************** ******* *    ****

62. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.788 

tggctgccgctcggcctcatcgccgc-cggcgcc	CRISPR spacer
gcgctgcggctcggcatcatcgccgcactgctc-	Protospacer
  ***** ******* ********** * ** *

63. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.788 

tggctgc--cgctcggcctcatcgccgccggcgcc	CRISPR spacer
--gccgtagtgctcggcctcagcgcagccggcgcc	Protospacer
  **.*.  .*********** *** *********

64. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_020275 (Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence) position: , mismatch: 7, identity: 0.788 

tggctgccg--ctcggcctcatcgccgccggcgcc	CRISPR spacer
--gacaccgccctcgaccacatcgccgccggcgcc	Protospacer
  * ..***  ****.** ****************

65. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 7, identity: 0.788 

tggctgcc--gctcggcctcatcgccgccggcgcc	CRISPR spacer
--accgcccgcctcgccctgatcgccgccggcgcc	Protospacer
  .*.***   **** *** ***************

66. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 7, identity: 0.788 

-tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
gtggacg-cgctcggcctgatcgccgcccgcgtg	Protospacer
 *** .* ********** ********* ***.

67. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
agccctggaaccggccggactgcgcggcccag	Protospacer
* * *   .********* *.***********

68. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
gccaggccgaccagccggcccgcgcggccgcc	Protospacer
.**. .******.****************

69. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NC_008383 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL8, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
accgcaccgaccggttggcccgcgattacaac	Protospacer
**************..********    * *

70. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP018231 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
accgcaccgaccggttggcccgcgattacaac	Protospacer
**************..********    * *

71. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP016292 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
accgcaccgaccggttggcccgcgattacaac	Protospacer
**************..********    * *

72. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
gaggccgggaccggccggcccgcccggcgcag	Protospacer
.  **   *************** **** ***

73. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP050090 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b4, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
accgcaccgaccggttggcccgcgattacaac	Protospacer
**************..********    * *

74. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to CP058906 (Micromonospora phage pMLP1, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
cctggggcgacccgccggccggcgcggcccac	Protospacer
 *.* . ***** ******* **********

75. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
agcacgtcgaccggccggcccgcgcaggccgc	Protospacer
* *.*..******************.* **.

76. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
cctacaccgaccggcatgcccgcgcgggcgcg	Protospacer
 *..***********  ********** *  *

77. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP021994 (Cryobacterium sp. LW097 plasmid unnamed1) position: , mismatch: 8, identity: 0.75 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
tcgcccctcaccggccggcccgcgagggccag	Protospacer
 *  * *. *************** ** ****

78. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gggctgccgctcggcgtcatcgcggcgatccg	Protospacer
 ************** ******* ** . *

79. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gggctgccgctcggcgtcatcgcggcgatccg	Protospacer
 ************** ******* ** . *

80. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gggctgccgctcggcgtcatcgcggcgatccg	Protospacer
 ************** ******* ** . *

81. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgc-cgctcggcctcatcgccgccggcgc	CRISPR spacer
-atccgcgtgctcggcctcatcgccgcagacga	Protospacer
 . *.** .****************** *.**

82. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP015268 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gtactgccgctgcgcctcatcgccgccgccct	Protospacer
  .********  *************** * .

83. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gtactgccgctgcgcctcatcgccgccgccct	Protospacer
  .********  *************** * .

84. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gggctgccgctcggcatcatcgcggcgatccg	Protospacer
 ************** ******* ** . *

85. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccg-----ctcggcctcatcgccgccggcgc	CRISPR spacer
-----gtcaagagcctcggcctcgtcgccgccggcgc	Protospacer
     *.*.     *********.*************

86. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gtcttctcgctcggcctgatcgccgccgtcgc	Protospacer
   .* .********** ********** ***

87. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.75 

--tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gcgggccat--ctcggccacgtcgccgccggcgc	Protospacer
   ***...  ******* *.*************

88. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NC_012725 (Burkholderia glumae BGR1 plasmid bglu_4p, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc----	CRISPR spacer
gcgctgccgctcgccctgatcgcc----gcgctgaa	Protospacer
  *********** *** ******    ****

89. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
cggggttcgctcggcctgatcgcggccggcgt	Protospacer
.**   .********** ***** *******.

90. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
cggggttcgctcggcctgatcgcggccggcgt	Protospacer
.**   .********** ***** *******.

91. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP035902 (Burkholderia glumae strain 257sh-1 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc----	CRISPR spacer
gcgctgccgctcgccctgatcgcc----gcgctaaa	Protospacer
  *********** *** ******    ****

92. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc-	CRISPR spacer
gcgctgcggctcggcatcatcgccg-cactgct	Protospacer
  ***** ******* ********* *. .**

93. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
ggattcccgctcggcttcttcgccgccggcat	Protospacer
 *..* *********.** ***********..

94. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
ggattcccgctcggcttcttcgccgccggcat	Protospacer
 *..* *********.** ***********..

95. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
cggggttcgctcggcctgatcgcggccggcgt	Protospacer
.**   .********** ***** *******.

96. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
ggattcccgctcggcttcttcgccgccggcat	Protospacer
 *..* *********.** ***********..

97. spacer 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75 

gataccgcgccgacaacggttttcg----cggcact	CRISPR spacer
gataccgcgccgacaacgttcttcagtttcag----	Protospacer
****************** *.***.    *.*

98. spacer 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

gataccgcgccgacaacggttttcg----cggcact	CRISPR spacer
gataccgcgccgacaacgttcttcagtttcag----	Protospacer
****************** *.***.    *.*

99. spacer 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75 

gataccgcgccgacaacggttttcg----cggcact	CRISPR spacer
gataccgcgccgacaacgttcttcagtttcag----	Protospacer
****************** *.***.    *.*

100. spacer 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75 

gataccgcgccgacaacggttttcg----cggcact	CRISPR spacer
gataccgcgccgacaacgttcttcagtttcag----	Protospacer
****************** *.***.    *.*

101. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.758 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
gtcttctcgctcggcctgatcgccgccgtcgcc	Protospacer
   .* .********** ********** ****

102. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 8, identity: 0.758 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
ggcctgccgctcggcgtcctcgccgcctcctcg	Protospacer
 * ************ ** ********  * *

103. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
tgggccatgctcggcctgatggccgccggcgca	Protospacer
*** .  .********* ** ***********

104. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.758 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
tgggccatgctcggcctgatggccgccggcgca	Protospacer
*** .  .********* ** ***********

105. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
ggattcccgctcggcttcttcgccgccggcatc	Protospacer
 *..* *********.** ***********..*

106. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
ggattcccgctcggcttcttcgccgccggcatc	Protospacer
 *..* *********.** ***********..*

107. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
ggattcccgctcggcttcttcgccgccggcatc	Protospacer
 *..* *********.** ***********..*

108. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccggcccgcgcaaggcgc	Protospacer
 .***.*******************..  *.

109. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccggcccgcgcaaggcgc	Protospacer
 .***.*******************..  *.

110. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ggggagccggccggctggcccgcgcggccccc	Protospacer
.  * .***.*****.**************

111. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccggcccgcgcaaggcgc	Protospacer
 .***.*******************..  *.

112. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccggcccgcgcaaggcgc	Protospacer
 .***.*******************..  *.

113. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccggcccgcgcaaggcgc	Protospacer
 .***.*******************..  *.

114. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccggcccgcgcaaggcgc	Protospacer
 .***.*******************..  *.

115. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccggcccgcgcaaggcgc	Protospacer
 .***.*******************..  *.

116. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ccgccgccggcccgccggcccgcgcggccgtc	Protospacer
 *  *.***.** ****************

117. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccggcccgcgcaaggcgc	Protospacer
 .***.*******************..  *.

118. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccggcccgcgcaaggcgc	Protospacer
 .***.*******************..  *.

119. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccggcccgcgcaaggcgc	Protospacer
 .***.*******************..  *.

120. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
cgcgcaccgaccggccgcgccgcgccggtgtg	Protospacer
  ***************  ****** * .  *

121. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
gtccggcccaccggccggcccgcgcgtcctcg	Protospacer
..*  .** ***************** **. *

122. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

123. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

124. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
gtccggcccaccggccggcccgcgcgtcctcg	Protospacer
..*  .** ***************** **. *

125. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

126. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ttcctgccgaccggcctgcccgcgccgccgac	Protospacer
 .* ..********** ******** *** *

127. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

128. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
acaccaccaaccggccggccagcgcggattca	Protospacer
**  ****.*********** ****** .. .

129. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

130. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ttcctgccgaccggcctgcccgcgccgccgac	Protospacer
 .* ..********** ******** *** *

131. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

132. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

133. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

134. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP010870 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ccggcaccgaccggcccgccggcgcgatggaa	Protospacer
 * ************* *** *****..  *.

135. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

136. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

137. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

138. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
gtccggcccaccggccggcccgcgcgtcctcg	Protospacer
..*  .** ***************** **. *

139. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
gacgcaccgaccggccggcacccgcccgcgat	Protospacer
. ***************** * ***   * *

140. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
cccgcaccgatcggccggccggcgatggtgaa	Protospacer
 *********.********* ***  * . *.

141. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

142. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

143. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

144. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

145. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

146. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

147. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

148. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
acaccaccaaccggccggccagcgcggattca	Protospacer
**  ****.*********** ****** .. .

149. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
acaccaccaaccggccggccagcgcggattca	Protospacer
**  ****.*********** ****** .. .

150. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

151. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

152. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

153. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

154. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

155. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

156. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
acaccaccaaccggccggccagcgcggattca	Protospacer
**  ****.*********** ****** .. .

157. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

158. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

159. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

160. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

161. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

162. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

163. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

164. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

165. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

166. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

167. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

168. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

169. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

170. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

171. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

172. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

173. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

174. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgccgaccggccagcccgcgcagggctc	Protospacer
 .***.**********.********.*  *

175. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 9, identity: 0.719 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
cccgcaccgaccggcgggccctcgatcaccgt	Protospacer
 ************** ***** **    **.

176. spacer 2.4|677984|35|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 9, identity: 0.743 

cggcgccggcggcctcggcccagaggggcgcgggt	CRISPR spacer
tcttgccggcggcctcggcggagaggggcgccagg	Protospacer
.  .***************  ********** .*

177. spacer 7.1|5047226|33|NZ_AP022870|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.727 

ggctgcccaacacccgccgccgcagtctcggtg	CRISPR spacer
gtctgcgcaacgcccgccgccgcagtagaagca	Protospacer
* **** ****.**************   .*..

178. spacer 7.1|5047226|33|NZ_AP022870|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.727 

ggctgcccaacacccgccgccgcagtctcggtg	CRISPR spacer
gtctgcgcaacgcccgccgccgcagtagaagca	Protospacer
* **** ****.**************   .*..

179. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.719 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
ccggcgcagctcggccgcatcgccgccgctga	Protospacer
. * .** ******** *********** .*

180. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gacctgccgcacggcctcgtcgccgccttccg	Protospacer
 . ******* *******.********  *

181. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
ccgctgccgctcggcctcctcgacggcacgga	Protospacer
. **************** *** ** *.  *

182. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
cgcgtgccgctcggcctcgtcgcggccgatct	Protospacer
.*  **************.**** ****.. .

183. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
taccgcccgctcgaccgcatcgccgccggtcg	Protospacer
*. *  *******.** ************.

184. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gacctgccgcacggcctcgtcgccgccttccg	Protospacer
 . ******* *******.********  *

185. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_LR536452 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 3) position: , mismatch: 9, identity: 0.719 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
cacgcggcgcgcggcctcatcgccggcggcgt	Protospacer
..  .* *** ************** *****.

186. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
cgagacgtgctcggccgcatcaccgccggcgc	Protospacer
.*.    .******** ****.**********

187. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gaggcggcgctcgaccgcatcgccgccggcaa	Protospacer
 .* .* ******.** *************.

188. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
gacctgccgcacggcctcgtcgccgccttccg	Protospacer
 . ******* *******.********  *

189. spacer 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder matches to MN694668 (Marine virus AFVG_250M472, complete genome) position: , mismatch: 9, identity: 0.719 

gataccgcgccgacaacggttttcgcggcact	CRISPR spacer
gggatttaccctacaacggttttagcggcact	Protospacer
*. *..   ** *********** ********

190. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
gacctgccgcacggcctcgtcgccgccttccgc	Protospacer
 . ******* *******.********  *  *

191. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP015268 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence) position: , mismatch: 9, identity: 0.727 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
gtactgccgctgcgcctcatcgccgccgccctg	Protospacer
  .********  *************** * .

192. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 9, identity: 0.727 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
gtactgccgctgcgcctcatcgccgccgccctg	Protospacer
  .********  *************** * .

193. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
cgagacgtgctcggccgcatcaccgccggcgcc	Protospacer
.*.    .******** ****.***********

194. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
cgcgtgccgctcggcctcgtcgcggccgatctc	Protospacer
.*  **************.**** ****.. .*

195. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.727 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
gacctgccgcacggcctcgtcgccgccttccgc	Protospacer
 . ******* *******.********  *  *

196. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_LR536452 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 3) position: , mismatch: 9, identity: 0.727 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
cacgcggcgcgcggcctcatcgccggcggcgtc	Protospacer
..  .* *** ************** *****.*

197. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 9, identity: 0.727 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
cggggttcgctcggcctgatcgcggccggcgtg	Protospacer
.**   .********** ***** *******.

198. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
gacctgccgcacggcctcgtcgccgccttccgc	Protospacer
 . ******* *******.********  *  *

199. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.727 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
gacctgccgcacggcctcgtcgccgccttccgc	Protospacer
 . ******* *******.********  *  *

200. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
gttccaccgcccgggcggcccgcgcggcgacc	Protospacer
... ***** **** *************

201. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
tggtgatggaccggccggaccgcgccgcccac	Protospacer
     *. ********** ****** *****

202. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgcccaccggccggcccgcgcaaggcgc	Protospacer
 .***.** ****************..  *.

203. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 10, identity: 0.688 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ccattaccgaccggccgcccctcgcggcggcc	Protospacer
 *  .************ *** ******

204. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgcccaccggccggcccgcgcaaggcgc	Protospacer
 .***.** ****************..  *.

205. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
ctcgcgcccaccggccggcccgcgcaaggcgc	Protospacer
 .***.** ****************..  *.

206. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 10, identity: 0.688 

----accgcaccgaccggccggcccgcgcggcccag--	CRISPR spacer
ctggaccgcgcggaccggccg------gtggcccggcg	Protospacer
    *****.* *********      *.*****.*

207. spacer 9.1|5177748|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

ttgccgagcgagagccacctcgtggtgtgcga	CRISPR spacer
caggtccgcgagggcgacctcgtggtgtgctg	Protospacer
. * .  *****.** ************** .

208. spacer 9.3|5177870|33|NZ_AP022870|CRISPRCasFinder matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 10, identity: 0.697 

ggcggtgtcgtcttcgggcggtggcggcacggc	CRISPR spacer
attggtgccgtcttcgggtggtggcggatatcc	Protospacer
. .****.**********.********     *

209. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 10, identity: 0.688 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
caggtgccggtcggcctcttcgccgccctgat	Protospacer
..* ***** ******** ********   ..

210. spacer 9.6|5178054|32|NZ_AP022870|CRISPRCasFinder matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 10, identity: 0.688 

tggctgccgctcggcctcatcgccgccggcgc	CRISPR spacer
accgcgccgctcggcctgatcggcgccgccta	Protospacer
    .************ **** ***** *

211. spacer 9.7|5178115|32|NZ_AP022870|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.688 

gataccgcgccgacaacggttttcgcggcact	CRISPR spacer
cgctctgcgccgacaacgttcttcgcggcggc	Protospacer
 .. *.************ *.********. .

212. spacer 9.10|5177870|34|NZ_AP022870|CRT,PILER-CR matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 10, identity: 0.706 

ggcggtgtcgtcttcgggcggtggcggcacggcg	CRISPR spacer
attggtgccgtcttcgggtggtggcggatatccg	Protospacer
. .****.**********.********     **

213. spacer 9.13|5178054|33|NZ_AP022870|CRT,PILER-CR matches to NC_012725 (Burkholderia glumae BGR1 plasmid bglu_4p, complete sequence) position: , mismatch: 10, identity: 0.697 

tggctgccgctcggcctcatcgccgccggcgcc	CRISPR spacer
gcgctgccgctcgccctgatcgccgcgctgaac	Protospacer
  *********** *** ********    . *

214. spacer 9.14|5178115|33|NZ_AP022870|CRT,PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.697 

gataccgcgccgacaacggttttcgcggcactc----	CRISPR spacer
gataccgcgccgacaacgttcttca----gtttcagg	Protospacer
****************** *.***.    ..*.

215. spacer 9.14|5178115|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.697 

gataccgcgccgacaacggttttcgcggcactc----	CRISPR spacer
gataccgcgccgacaacgttcttca----gtttcagg	Protospacer
****************** *.***.    ..*.

216. spacer 9.14|5178115|33|NZ_AP022870|CRT,PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 10, identity: 0.697 

gataccgcgccgacaacggttttcgcggcactc----	CRISPR spacer
gataccgcgccgacaacgttcttca----gtttcagg	Protospacer
****************** *.***.    ..*.

217. spacer 9.14|5178115|33|NZ_AP022870|CRT,PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 10, identity: 0.697 

gataccgcgccgacaacggttttcgcggcactc----	CRISPR spacer
gataccgcgccgacaacgttcttca----gtttcagg	Protospacer
****************** *.***.    ..*.

218. spacer 2.1|677810|32|NZ_AP022870|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 12, identity: 0.625 

----accgcaccgaccggccggcccgcgcggcccag	CRISPR spacer
cgagcccgcgcaggccggccgg---gcggtggccg-	Protospacer
     ****.* *.********   ***  * **.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage