Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP050840 Klebsiella pneumoniae strain Bckp101 chromosome, complete genome 3 crisprs csa3,cas3,DEDDh,DinG,RT,WYL 0 1 6 0
NZ_CP050841 Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP050842 Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP050840
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050840_1 3621796-3621878 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050840_2 4260018-4260157 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050840_3 4477039-4477133 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050840_1 1.1|3621824|27|NZ_CP050840|CRISPRCasFinder 3621824-3621850 27 NZ_CP015439 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_1, complete sequence 57276-57302 5 0.815

1. spacer 1.1|3621824|27|NZ_CP050840|CRISPRCasFinder matches to NZ_CP015439 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_1, complete sequence) position: , mismatch: 5, identity: 0.815

tgctattgcgcgattattttgccgggt	CRISPR spacer
agctattgcgcgactatgttgccgtgc	Protospacer
 ************.*** ****** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1704592 : 1711509 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_2 2695671 : 2706558 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_3 2872885 : 2926833 48 Escherichia_phage(37.5%) plate,tRNA,transposase NA
DBSCAN-SWA_4 3098949 : 3143459 54 Enterobacteria_phage(57.58%) tRNA,head,tail,integrase,terminase,portal,plate,capsid attL 3104177:3104194|attR 3139725:3139742
DBSCAN-SWA_5 3163144 : 3218285 66 Klebsiella_phage(25.49%) head,tail,integrase,portal,holin,terminase,protease,capsid attL 3161301:3161315|attR 3218625:3218639
DBSCAN-SWA_6 3484395 : 3493859 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage