Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP051636 Avibacterium paragallinarum strain ADL-AP17 chromosome, complete genome 1 crisprs PD-DExK,cas3,DinG,DEDDh,cas2,WYL,cas14j 0 1 4 0

Results visualization

1. NZ_CP051636
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051636_1 624230-624356 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP051636_1 1.1|624266|55|NZ_CP051636|CRISPRCasFinder 624266-624320 55 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 454272-454326 10 0.818
NZ_CP051636_1 1.1|624266|55|NZ_CP051636|CRISPRCasFinder 624266-624320 55 NZ_CP048065 Piscirickettsia salmonis strain Ps-8942B plasmid Ps8942B-p9, complete sequence 33562-33616 11 0.8
NZ_CP051636_1 1.1|624266|55|NZ_CP051636|CRISPRCasFinder 624266-624320 55 CP022016 Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence 202572-202626 12 0.782
NZ_CP051636_1 1.1|624266|55|NZ_CP051636|CRISPRCasFinder 624266-624320 55 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 683766-683820 18 0.673

1. spacer 1.1|624266|55|NZ_CP051636|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.818

tatcttatctcttgcgggaatagctcagttggtagagcacaaccttgccatggtt	CRISPR spacer
gcactgctcccaagcgggaatagctcagttggtagagcgcaaccttgccaaggtt	Protospacer
   **  **.*  *************************.*********** ****

2. spacer 1.1|624266|55|NZ_CP051636|CRISPRCasFinder matches to NZ_CP048065 (Piscirickettsia salmonis strain Ps-8942B plasmid Ps8942B-p9, complete sequence) position: , mismatch: 11, identity: 0.8

tatcttatctcttgcgggaatagctcagttggtagagcacaaccttgccatggtt	CRISPR spacer
cctttccagttgcgcgggaatagctcagttggtagagcacaaccttgccaaggtt	Protospacer
. *.*.   *. .************************************* ****

3. spacer 1.1|624266|55|NZ_CP051636|CRISPRCasFinder matches to CP022016 (Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.782

tatcttatctcttgcgggaatagctcagttggtagagcacaaccttgccatggtt	CRISPR spacer
gttgcttgatactgcgggaatagctcagttggtagagcacgaccttgccaaggtc	Protospacer
  * .*   * .****************************.********* ***.

4. spacer 1.1|624266|55|NZ_CP051636|CRISPRCasFinder matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 18, identity: 0.673

tatcttatctctt-----------gcgggaatagctcagttggtagagcacaaccttgcc	CRISPR spacer
-----------ttagaagtaaaaagcggaaatagctcagttggtagagcacaaccttgcc	Protospacer
           **           ****.*******************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 257969 : 279069 33 Mannheimia_phage(44.44%) integrase attL 255979:256030|attR 282214:282265
DBSCAN-SWA_2 285938 : 292418 10 Mannheimia_phage(25.0%) integrase attL 280907:280922|attR 293415:293430
DBSCAN-SWA_3 1464830 : 1487798 37 Mannheimia_phage(52.63%) NA NA
DBSCAN-SWA_4 1678783 : 1765614 105 Haemophilus_phage(23.94%) tRNA,plate,holin,tail,terminase,transposase,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage