Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040616 Campylobacter sp. CFSAN093257 chromosome, complete genome 1 crisprs DEDDh,WYL,cas14j,cas2,cas1,cas9,csa3 0 1 3 0

Results visualization

1. NZ_CP040616
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040616_1 1536183-1536284 TypeII NA
1 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040616_1 1.1|1536219|30|NZ_CP040616|CRISPRCasFinder 1536219-1536248 30 MN530981 Campylobacter phage DA10, complete genome 8023-8052 3 0.9
NZ_CP040616_1 1.1|1536219|30|NZ_CP040616|CRISPRCasFinder 1536219-1536248 30 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 869171-869200 7 0.767
NZ_CP040616_1 1.1|1536219|30|NZ_CP040616|CRISPRCasFinder 1536219-1536248 30 MT774377 CrAssphage cr107_1, complete genome 30099-30128 7 0.767

1. spacer 1.1|1536219|30|NZ_CP040616|CRISPRCasFinder matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 3, identity: 0.9

tagtgatggtaattggcttgaaaatatagg	CRISPR spacer
tagcgatggcaattggcttgaaaatataga	Protospacer
***.*****.*******************.

2. spacer 1.1|1536219|30|NZ_CP040616|CRISPRCasFinder matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

tagtgatggtaattggcttgaaaatatagg	CRISPR spacer
aagatttggtaattggcttgaaaatctaaa	Protospacer
 **   ******************* **..

3. spacer 1.1|1536219|30|NZ_CP040616|CRISPRCasFinder matches to MT774377 (CrAssphage cr107_1, complete genome) position: , mismatch: 7, identity: 0.767

tagtgatggtaattggcttgaaaatatagg	CRISPR spacer
tagtgacggtaattggattgaaagtgctga	Protospacer
******.********* ******.*.. *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 486627 : 495074 12 Campylobacter_phage(90.0%) NA NA
DBSCAN-SWA_2 636941 : 738255 108 Campylobacter_phage(43.9%) protease,integrase,transposase,capsid,plate,tRNA,tail,terminase attL 689948:689966|attR 724797:724815
DBSCAN-SWA_3 1439135 : 1445771 8 Tupanvirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage