Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP051883 Aeromonas salmonicida strain SRW-OG1 chromosome, complete genome 14 crisprs DEDDh,cas3,DinG,WYL,csa3,RT 1 4 348 0

Results visualization

1. NZ_CP051883
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_1 72252-72383 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_2 344174-344493 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_3 648010-648117 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_4 1650549-1650683 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_5 1811117-1811212 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_6 1977421-1977528 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_7 2622127-2622231 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_8 3183652-3183752 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_9 3315826-3315925 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_10 3401732-3401880 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_11 3579455-3579541 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_12 3632625-3632737 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_13 4214891-4215025 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051883_14 4578916-4579031 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP051883_12 12.1|3632668|27|NZ_CP051883|CRISPRCasFinder 3632668-3632694 27 NZ_CP051883.1 3632738-3632764 2 0.926

1. spacer 12.1|3632668|27|NZ_CP051883|CRISPRCasFinder matches to position: 3632738-3632764, mismatch: 2, identity: 0.926

gttttttacgggttgccgttgcggtgg	CRISPR spacer
gttttttatgagttgccgttgcggtgg	Protospacer
********.*.****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP051883_12 12.1|3632668|27|NZ_CP051883|CRISPRCasFinder 3632668-3632694 27 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 472179-472205 4 0.852
NZ_CP051883_12 12.1|3632668|27|NZ_CP051883|CRISPRCasFinder 3632668-3632694 27 KY271397 Klebsiella phage 3 LV-2017, complete genome 26443-26469 5 0.815
NZ_CP051883_2 2.5|344437|34|NZ_CP051883|CRISPRCasFinder 344437-344470 34 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 613160-613193 8 0.765
NZ_CP051883_2 2.1|344197|34|NZ_CP051883|CRISPRCasFinder 344197-344230 34 NZ_CP031599 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence 201106-201139 9 0.735
NZ_CP051883_2 2.1|344197|34|NZ_CP051883|CRISPRCasFinder 344197-344230 34 NC_019125 Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence 49111-49144 10 0.706
NZ_CP051883_2 2.3|344323|34|NZ_CP051883|CRISPRCasFinder 344323-344356 34 MN204498 Streptomyces phage Saftant, complete genome 9605-9638 10 0.706
NZ_CP051883_2 2.1|344197|34|NZ_CP051883|CRISPRCasFinder 344197-344230 34 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 126471-126504 11 0.676
NZ_CP051883_2 2.1|344197|34|NZ_CP051883|CRISPRCasFinder 344197-344230 34 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 126471-126504 11 0.676
NZ_CP051883_2 2.3|344323|34|NZ_CP051883|CRISPRCasFinder 344323-344356 34 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 92136-92169 11 0.676

1. spacer 12.1|3632668|27|NZ_CP051883|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

gttttttacgggttgccgttgcggtgg	CRISPR spacer
gttttttgcggattgccgttgcggtca	Protospacer
*******.***.************* .

2. spacer 12.1|3632668|27|NZ_CP051883|CRISPRCasFinder matches to KY271397 (Klebsiella phage 3 LV-2017, complete genome) position: , mismatch: 5, identity: 0.815

gttttttacgggttgccgttgcggtgg	CRISPR spacer
atttttttcgggttgccgtagcggtca	Protospacer
.****** *********** ***** .

3. spacer 2.5|344437|34|NZ_CP051883|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.765

gacccgggtcggtgacggcgatctctcggccgtg	CRISPR spacer
cgcgcgggtcggtgacggcgaactctctgcccat	Protospacer
 .* ***************** ***** ***   

4. spacer 2.1|344197|34|NZ_CP051883|CRISPRCasFinder matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 9, identity: 0.735

gaccaagctgggtgccggccagctgaccgccgga	CRISPR spacer
gcgcccttgggttgcgggccagctgaccgccgga	Protospacer
*  *   . ** *** ******************

5. spacer 2.1|344197|34|NZ_CP051883|CRISPRCasFinder matches to NC_019125 (Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence) position: , mismatch: 10, identity: 0.706

gaccaagctgggtgccggccagctgaccgccgga	CRISPR spacer
cgggcagtccggtgccggtcagcagaccgccgga	Protospacer
 .   **.. ********.**** **********

6. spacer 2.3|344323|34|NZ_CP051883|CRISPRCasFinder matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 10, identity: 0.706

caccaagaagggcaatggcaaggtgcaggccatc	CRISPR spacer
gcccaagaagcgcaagggcaaggtgcacctctga	Protospacer
  ******** **** ***********  .*   

7. spacer 2.1|344197|34|NZ_CP051883|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 11, identity: 0.676

gaccaagctgggtgccggccagctgaccgccgga	CRISPR spacer
caaggagctgcgtgccggcccgctgaccgagctt	Protospacer
 *  .***** ********* ********     

8. spacer 2.1|344197|34|NZ_CP051883|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 11, identity: 0.676

gaccaagctgggtgccggccagctgaccgccgga	CRISPR spacer
caaggagctgcgtgccggcccgctgaccgagctt	Protospacer
 *  .***** ********* ********     

9. spacer 2.3|344323|34|NZ_CP051883|CRISPRCasFinder matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 11, identity: 0.676

caccaagaagggcaatggcaaggtgcaggccatc	CRISPR spacer
ttccaagaagaccaatggcaaggtgccactggta	Protospacer
. ********. ************** . . .* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 36588 30 Bacillus_phage(66.67%) tRNA NA
DBSCAN-SWA_2 41792 : 42983 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_3 51765 : 54345 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_4 58355 : 59396 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_5 68347 : 69304 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_6 72340 : 73384 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_7 77323 : 80413 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_8 87929 : 90650 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_9 95545 : 96373 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_10 101126 : 102767 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_11 109437 : 111630 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_12 115092 : 121151 7 Vibrio_phage(25.0%) tRNA NA
DBSCAN-SWA_13 135722 : 136319 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_14 143042 : 144602 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_15 151396 : 152119 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_16 159808 : 160756 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_17 164031 : 173711 11 Pseudomonas_phage(16.67%) transposase NA
DBSCAN-SWA_18 185010 : 191110 6 uncultured_Caudovirales_phage(33.33%) protease NA
DBSCAN-SWA_19 197608 : 198931 1 Arthrobacter_phage(100.0%) NA NA
DBSCAN-SWA_20 202145 : 206443 4 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_21 213848 : 220068 4 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_22 238887 : 242852 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_23 248207 : 249089 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_24 252600 : 255434 3 Pelagibacter_phage(50.0%) NA NA
DBSCAN-SWA_25 258562 : 261337 2 environmental_Halophage(50.0%) NA NA
DBSCAN-SWA_26 273662 : 283803 6 Bacillus_phage(25.0%) transposase NA
DBSCAN-SWA_27 295168 : 295930 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_28 303306 : 308212 6 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_29 312959 : 314179 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_30 324681 : 327747 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_31 334391 : 340824 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_32 357069 : 358289 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_33 385715 : 386099 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_34 391838 : 395265 6 Natrialba_phage(50.0%) NA NA
DBSCAN-SWA_35 402865 : 403450 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_36 416443 : 420524 4 Bodo_saltans_virus(50.0%) tRNA NA
DBSCAN-SWA_37 431954 : 432446 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_38 443295 : 444919 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_39 449687 : 450257 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_40 464198 : 465341 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_41 471215 : 471899 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_42 485005 : 488848 1 Micromonas_pusilla_virus(100.0%) NA NA
DBSCAN-SWA_43 493422 : 496019 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_44 508620 : 509532 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_45 516912 : 518004 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_46 533751 : 535460 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_47 542830 : 643741 106 Burkholderia_phage(14.29%) holin,lysis,plate,integrase,transposase,capsid,tail,head,portal,tRNA,terminase attL 590871:590892|attR 632487:632508
DBSCAN-SWA_48 649313 : 650327 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_49 664781 : 668779 4 Cedratvirus(33.33%) NA NA
DBSCAN-SWA_50 675134 : 676271 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_51 683152 : 684031 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_52 687262 : 688558 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_53 701738 : 703883 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_54 725037 : 727416 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_55 732161 : 734039 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_56 751302 : 751959 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_57 758203 : 761790 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_58 769964 : 771629 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_59 777293 : 778829 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_60 784524 : 792691 5 Diachasmimorpha_longicaudata_entomopoxvirus(33.33%) transposase NA
DBSCAN-SWA_61 802691 : 803990 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_62 808816 : 812794 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_63 816906 : 818583 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_64 828669 : 831901 3 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_65 837734 : 840692 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_66 848139 : 853600 3 uncultured_Mediterranean_phage(33.33%) protease NA
DBSCAN-SWA_67 871181 : 871787 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_68 875055 : 878456 5 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_69 883827 : 885765 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_70 891498 : 895175 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_71 898902 : 900343 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_72 903872 : 911782 6 Escherichia_coli_O157_typing_phage(33.33%) NA NA
DBSCAN-SWA_73 919312 : 920101 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_74 927442 : 929374 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_75 939445 : 941314 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_76 951546 : 953460 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_77 957555 : 959187 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_78 970328 : 990288 11 Tupanvirus(50.0%) transposase NA
DBSCAN-SWA_79 998315 : 1006896 6 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_80 1010786 : 1012250 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_81 1015931 : 1024228 6 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_82 1028365 : 1029400 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_83 1034929 : 1035628 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_84 1039901 : 1048893 6 Agrobacterium_phage(20.0%) protease NA
DBSCAN-SWA_85 1063204 : 1068716 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_86 1076068 : 1076830 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_87 1090685 : 1098909 7 Organic_Lake_phycodnavirus(33.33%) NA NA
DBSCAN-SWA_88 1108202 : 1110623 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_89 1157365 : 1164158 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_90 1174746 : 1207399 26 Enterobacteria_phage(16.67%) tRNA NA
DBSCAN-SWA_91 1210533 : 1216804 6 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_92 1222791 : 1224807 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_93 1235477 : 1239894 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_94 1247858 : 1249829 1 Eastern_grey_kangaroopox_virus(100.0%) NA NA
DBSCAN-SWA_95 1269425 : 1270067 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_96 1273257 : 1274386 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_97 1286976 : 1288266 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_98 1292933 : 1294364 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_99 1301208 : 1310809 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_100 1315252 : 1318578 2 Bacteriophage(50.0%) NA NA
DBSCAN-SWA_101 1323012 : 1329126 5 Staphylococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_102 1334993 : 1347726 9 Bodo_saltans_virus(40.0%) NA NA
DBSCAN-SWA_103 1357742 : 1358513 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_104 1367450 : 1370437 5 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_105 1384419 : 1385916 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_106 1400121 : 1403598 5 Molluscum_contagiosum_virus(33.33%) NA NA
DBSCAN-SWA_107 1415888 : 1427059 6 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_108 1430391 : 1431768 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_109 1436031 : 1441745 3 Megavirus(50.0%) NA NA
DBSCAN-SWA_110 1453194 : 1454712 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_111 1458075 : 1463306 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_112 1480869 : 1482390 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_113 1510315 : 1512598 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_114 1541837 : 1543337 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_115 1580858 : 1586554 4 Hokovirus(50.0%) integrase attL 1574831:1574844|attR 1591188:1591201
DBSCAN-SWA_116 1593015 : 1594680 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_117 1610826 : 1642528 26 Planktothrix_phage(13.33%) tRNA,protease NA
DBSCAN-SWA_118 1654543 : 1658746 4 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_119 1663954 : 1664446 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_120 1681335 : 1692808 6 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_121 1702463 : 1709532 8 Mycoplasma_phage(33.33%) NA NA
DBSCAN-SWA_122 1713437 : 1721642 8 uncultured_Mediterranean_phage(75.0%) tRNA NA
DBSCAN-SWA_123 1724771 : 1732413 5 Bacillus_virus(33.33%) transposase NA
DBSCAN-SWA_124 1743025 : 1745949 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_125 1752108 : 1753740 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_126 1779205 : 1782996 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_127 1788512 : 1789163 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_128 1795043 : 1796210 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_129 1800342 : 1804851 5 Escherichia_phage(40.0%) NA NA
DBSCAN-SWA_130 1808414 : 1813044 5 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_131 1819790 : 1822831 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_132 1827229 : 1828279 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_133 1843019 : 1848188 4 Edwardsiella_phage(33.33%) NA NA
DBSCAN-SWA_134 1855222 : 1856026 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_135 1891596 : 1894323 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_136 1897599 : 1898700 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_137 1913588 : 1920000 6 Hokovirus(33.33%) NA NA
DBSCAN-SWA_138 1924463 : 1931479 7 Shigella_phage(25.0%) transposase NA
DBSCAN-SWA_139 1935550 : 1940069 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_140 1955805 : 1956468 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_141 1962437 : 1967354 7 Mycobacterium_phage(50.0%) tRNA NA
DBSCAN-SWA_142 1970484 : 1971960 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_143 1978343 : 1981390 2 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_144 1996626 : 2000410 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_145 2010641 : 2014373 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_146 2019546 : 2023711 4 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_147 2029932 : 2031581 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_148 2043988 : 2049157 6 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_149 2068855 : 2069344 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_150 2075222 : 2078292 3 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_151 2083206 : 2084460 1 Phage_21(100.0%) NA NA
DBSCAN-SWA_152 2112951 : 2113758 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_153 2121262 : 2123755 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_154 2130475 : 2131204 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_155 2138023 : 2141205 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_156 2148693 : 2154332 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_157 2163556 : 2164861 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_158 2171663 : 2176568 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_159 2199274 : 2202782 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_160 2210631 : 2215676 5 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_161 2223099 : 2225967 2 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_162 2237311 : 2238838 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_163 2247291 : 2247951 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_164 2264343 : 2265039 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_165 2270034 : 2271330 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_166 2276119 : 2279557 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_167 2283663 : 2298544 11 Anomala_cuprea_entomopoxvirus(16.67%) protease NA
DBSCAN-SWA_168 2306019 : 2307276 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_169 2318244 : 2325439 5 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_170 2339894 : 2344003 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_171 2354309 : 2355086 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_172 2374662 : 2382089 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_173 2387250 : 2389392 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_174 2400762 : 2401314 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_175 2424557 : 2431100 5 Ralstonia_phage(33.33%) NA NA
DBSCAN-SWA_176 2434203 : 2434671 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_177 2441099 : 2443417 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_178 2454726 : 2456670 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_179 2465894 : 2469830 5 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_180 2473294 : 2474890 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_181 2488565 : 2493059 4 Phage_TP(25.0%) tRNA NA
DBSCAN-SWA_182 2509640 : 2515376 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_183 2527626 : 2530239 1 Sucra_jujuba_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_184 2545405 : 2553468 7 Brazilian_cedratvirus(25.0%) NA NA
DBSCAN-SWA_185 2570364 : 2572059 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_186 2576237 : 2577209 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_187 2582421 : 2586102 2 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_188 2591218 : 2606487 10 Hokovirus(50.0%) NA NA
DBSCAN-SWA_189 2622195 : 2623914 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_190 2636337 : 2641537 4 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_191 2648308 : 2648659 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_192 2662536 : 2665002 1 Niemeyer_virus(100.0%) NA NA
DBSCAN-SWA_193 2668265 : 2674157 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_194 2677971 : 2678502 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_195 2697915 : 2700021 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_196 2711379 : 2712390 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_197 2721259 : 2726226 3 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_198 2732730 : 2734521 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_199 2756916 : 2763683 6 Lactococcus_phage(33.33%) NA NA
DBSCAN-SWA_200 2777123 : 2779985 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_201 2784843 : 2790224 4 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_202 2805096 : 2808641 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_203 2812637 : 2813132 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_204 2817226 : 2818360 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_205 2823010 : 2832180 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_206 2866292 : 2867360 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_207 2880720 : 2881632 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_208 2889552 : 2889984 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_209 2894234 : 2898433 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_210 2901450 : 2902788 1 Pontimonas_phage(100.0%) NA NA
DBSCAN-SWA_211 2907059 : 2907824 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_212 2912934 : 2913345 1 Leucania_separata_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_213 2920280 : 2920565 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_214 2925829 : 2930104 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_215 2933397 : 2945554 10 Vibrio_phage(16.67%) NA NA
DBSCAN-SWA_216 2969302 : 2970814 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_217 2994012 : 2998007 3 Bacillus_thuringiensis_phage(100.0%) tRNA NA
DBSCAN-SWA_218 3009412 : 3010324 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_219 3017241 : 3019500 1 Hokovirus(100.0%) protease NA
DBSCAN-SWA_220 3023795 : 3026309 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_221 3032228 : 3032801 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_222 3044062 : 3044968 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_223 3062888 : 3067682 6 Streptococcus_phage(33.33%) protease NA
DBSCAN-SWA_224 3074035 : 3076617 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_225 3084885 : 3092415 10 Corynebacterium_phage(20.0%) NA NA
DBSCAN-SWA_226 3115951 : 3125733 6 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_227 3129152 : 3129365 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_228 3134756 : 3142959 9 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_229 3149198 : 3154879 2 Virus_Rctr197k(50.0%) NA NA
DBSCAN-SWA_230 3167031 : 3168039 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_231 3173671 : 3175120 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_232 3189614 : 3190973 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_233 3198146 : 3213562 11 Tupanvirus(20.0%) NA NA
DBSCAN-SWA_234 3217346 : 3220103 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_235 3224397 : 3230368 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_236 3243780 : 3248449 3 Heterosigma_akashiwo_virus(50.0%) NA NA
DBSCAN-SWA_237 3263417 : 3265889 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_238 3268915 : 3269836 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_239 3277070 : 3289815 9 Sodalis_phage(20.0%) NA NA
DBSCAN-SWA_240 3296255 : 3302532 6 Sinorhizobium_phage(33.33%) tRNA,protease NA
DBSCAN-SWA_241 3312309 : 3319963 7 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_242 3324372 : 3325527 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_243 3333314 : 3334304 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_244 3339640 : 3341775 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_245 3345781 : 3346933 1 Aeromonas_virus(100.0%) NA NA
DBSCAN-SWA_246 3351684 : 3354061 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_247 3366015 : 3368087 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_248 3382624 : 3384271 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_249 3398457 : 3399231 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_250 3406511 : 3408944 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_251 3413977 : 3414661 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_252 3418933 : 3430824 10 Tupanvirus(14.29%) tRNA NA
DBSCAN-SWA_253 3438945 : 3439563 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_254 3450865 : 3451111 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_255 3456387 : 3457794 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_256 3474655 : 3475660 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_257 3479468 : 3480957 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_258 3491854 : 3508284 16 Indivirus(28.57%) NA NA
DBSCAN-SWA_259 3520748 : 3523429 2 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_260 3528939 : 3530301 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_261 3537459 : 3539168 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_262 3546918 : 3547683 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_263 3554450 : 3560704 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_264 3565156 : 3571450 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_265 3574652 : 3576365 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_266 3579569 : 3586753 7 Rhizobium_phage(20.0%) NA NA
DBSCAN-SWA_267 3595141 : 3597199 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_268 3604094 : 3605444 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_269 3616735 : 3619969 3 Bordetella_phage(50.0%) NA NA
DBSCAN-SWA_270 3630020 : 3631814 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_271 3639881 : 3644805 5 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_272 3662830 : 3671141 11 Xanthomonas_phage(20.0%) NA NA
DBSCAN-SWA_273 3676156 : 3677179 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_274 3683825 : 3684449 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_275 3687961 : 3690009 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_276 3694688 : 3697445 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_277 3704166 : 3705132 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_278 3710727 : 3711855 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_279 3715822 : 3726109 9 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_280 3736516 : 3739279 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_281 3744182 : 3744725 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_282 3752462 : 3753803 1 Alteromonas_phage(100.0%) NA NA
DBSCAN-SWA_283 3758303 : 3759773 2 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_284 3763240 : 3763744 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_285 3774718 : 3775774 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_286 3797319 : 3798539 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_287 3811332 : 3813359 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_288 3857307 : 3868923 12 Halocynthia_phage(20.0%) NA NA
DBSCAN-SWA_289 3874512 : 3876045 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_290 3886026 : 3886917 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_291 3899391 : 3900432 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_292 3912117 : 3918091 4 Burkholderia_virus(33.33%) NA NA
DBSCAN-SWA_293 3922352 : 3932963 8 Phage_NCTB(20.0%) NA NA
DBSCAN-SWA_294 3946875 : 3947511 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_295 3953768 : 3954341 1 Micromonas_pusilla_virus(100.0%) NA NA
DBSCAN-SWA_296 3973563 : 3974532 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_297 3977870 : 3978650 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_298 3982918 : 3983848 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_299 3996386 : 3996923 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_300 4005926 : 4007195 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_301 4015237 : 4017318 3 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_302 4029476 : 4030883 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_303 4040763 : 4042760 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_304 4055101 : 4059872 4 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_305 4064547 : 4073515 7 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_306 4083353 : 4084622 1 Serratia_phage(100.0%) tRNA NA
DBSCAN-SWA_307 4103382 : 4113088 8 uncultured_Caudovirales_phage(33.33%) tRNA NA
DBSCAN-SWA_308 4117414 : 4122483 3 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_309 4127927 : 4135985 9 Erysipelothrix_phage(25.0%) NA NA
DBSCAN-SWA_310 4146084 : 4146357 1 Serratia_phage(100.0%) NA NA
DBSCAN-SWA_311 4151804 : 4153028 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_312 4165622 : 4168752 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_313 4175322 : 4176576 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_314 4190793 : 4199007 6 Stenotrophomonas_phage(16.67%) NA NA
DBSCAN-SWA_315 4202161 : 4204048 2 Mollivirus(50.0%) NA NA
DBSCAN-SWA_316 4207231 : 4208011 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_317 4248506 : 4252761 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_318 4256136 : 4258612 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_319 4262726 : 4264157 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_320 4269032 : 4270670 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_321 4273830 : 4274520 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_322 4292334 : 4298599 7 Sinorhizobium_phage(33.33%) NA NA
DBSCAN-SWA_323 4312401 : 4317199 3 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_324 4320683 : 4336481 16 uncultured_Mediterranean_phage(20.0%) tRNA NA
DBSCAN-SWA_325 4342683 : 4344276 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_326 4347593 : 4348190 1 Ugandan_cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_327 4357207 : 4358293 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_328 4363921 : 4365891 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_329 4369530 : 4372398 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_330 4386303 : 4387158 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_331 4392477 : 4395000 2 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_332 4428921 : 4431252 3 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_333 4443370 : 4446931 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_334 4450906 : 4452586 1 Catovirus(100.0%) holin NA
DBSCAN-SWA_335 4463812 : 4469071 4 Diachasmimorpha_longicaudata_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_336 4474411 : 4477411 1 Mimivirus(100.0%) NA NA
DBSCAN-SWA_337 4482854 : 4485461 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_338 4490375 : 4492369 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_339 4497996 : 4500444 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_340 4510351 : 4511173 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_341 4518815 : 4519571 1 Campylobacter_phage(100.0%) NA NA
DBSCAN-SWA_342 4527385 : 4528948 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_343 4540148 : 4542332 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_344 4549968 : 4554754 3 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_345 4561176 : 4563021 1 Salinibacter_virus(100.0%) NA NA
DBSCAN-SWA_346 4581563 : 4586474 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_347 4590728 : 4601467 12 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_348 4612542 : 4615400 2 Micromonas_pusilla_virus(50.0%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage