Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP051547 Pseudomonas aeruginosa strain AA2 chromosome, complete genome 3 crisprs csa3,DEDDh,cas3,PD-DExK,DinG,WYL 0 1 3 0

Results visualization

1. NZ_CP051547
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051547_1 346609-346722 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051547_2 1868728-1868829 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP051547_3 2757324-2757460 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP051547_2 2.1|1868753|52|NZ_CP051547|CRISPRCasFinder 1868753-1868804 52 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63842 0 1.0

1. spacer 2.1|1868753|52|NZ_CP051547|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	CRISPR spacer
tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	Protospacer
****************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 639363 : 719715 84 Pseudomonas_phage(34.21%) tail,tRNA,plate NA
DBSCAN-SWA_2 1448195 : 1457224 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 2549719 : 2556613 9 uncultured_Caudovirales_phage(85.71%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage