Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP052856 Pseudomonas sp. ADAK22 chromosome, complete genome 2 crisprs DinG,csa3,WYL,DEDDh,cas3 1 0 8 0

Results visualization

1. NZ_CP052856
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP052856_1 298753-298854 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP052856_2 661297-661380 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP052856_2 2.1|661320|38|NZ_CP052856|CRISPRCasFinder 661320-661357 38 NZ_CP052856.1 660784-660821 0 1.0

1. spacer 2.1|661320|38|NZ_CP052856|CRISPRCasFinder matches to position: 660784-660821, mismatch: 0, identity: 1.0

ctgtgagtttgcacctttggcactgacccacggctttc	CRISPR spacer
ctgtgagtttgcacctttggcactgacccacggctttc	Protospacer
**************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1123069 : 1194822 94 Pseudomonas_phage(48.08%) tail,terminase,lysis,bacteriocin,integrase,coat,capsid attL 1117348:1117364|attR 1178369:1178385
DBSCAN-SWA_2 1199908 : 1212160 23 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 1708711 : 1775361 54 uncultured_Caudovirales_phage(35.29%) protease,plate,tRNA NA
DBSCAN-SWA_4 1884138 : 1953732 57 Escherichia_phage(18.18%) protease,coat,tRNA NA
DBSCAN-SWA_5 3802387 : 3851738 42 Tupanvirus(20.0%) protease,holin NA
DBSCAN-SWA_6 5214458 : 5225021 16 Pseudomonas_phage(100.0%) tail,integrase attL 5218319:5218333|attR 5229357:5229371
DBSCAN-SWA_7 5691228 : 5785045 91 uncultured_Caudovirales_phage(26.67%) tail,lysis,tRNA,plate,holin NA
DBSCAN-SWA_8 5846980 : 5851967 6 uncultured_Mediterranean_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage