Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP052860 Pseudomonas sp. ADAK13 chromosome, complete genome 2 crisprs csa3,DEDDh,WYL,cas3,DinG,RT,PD-DExK 1 0 7 0

Results visualization

1. NZ_CP052860
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP052860_1 1605453-1605559 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP052860_2 4744599-4744693 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP052860_2 2.1|4744633|27|NZ_CP052860|CRISPRCasFinder 4744633-4744659 27 NZ_CP052860.1 3170705-3170731 1 0.963

1. spacer 2.1|4744633|27|NZ_CP052860|CRISPRCasFinder matches to position: 3170705-3170731, mismatch: 1, identity: 0.963

tgtggtgaggggggcttgccctgtggt	CRISPR spacer
tgtggtgaggggggcttgtcctgtggt	Protospacer
******************.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 741258 : 833037 91 Pseudomonas_phage(44.74%) plate,tail,tRNA,holin,lysis,transposase NA
DBSCAN-SWA_2 2783196 : 2832289 44 Catovirus(20.0%) holin,protease NA
DBSCAN-SWA_3 3554431 : 3562856 10 Synechococcus_phage(28.57%) tRNA NA
DBSCAN-SWA_4 6224577 : 6266112 57 Pseudomonas_phage(45.24%) terminase,bacteriocin,tail,lysis,coat,capsid NA
DBSCAN-SWA_5 6272413 : 6284664 20 uncultured_Caudovirales_phage(42.86%) integrase attL 6271023:6271039|attR 6290594:6290610
DBSCAN-SWA_6 6816039 : 6823038 9 uncultured_Caudovirales_phage(85.71%) tRNA NA
DBSCAN-SWA_7 7088289 : 7135795 40 Catovirus(16.67%) protease,coat,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage