Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP052760 Pseudomonas aeruginosa strain LYT4 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP052759 Pseudomonas aeruginosa strain LYT4 chromosome, complete genome 2 crisprs csa3,DEDDh,cas3,DinG,WYL,cas4 0 1 9 3

Results visualization

1. NZ_CP052760
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18090 : 57006 50 Lysinibacillus_phage(20.0%) integrase,transposase attL 14042:14055|attR 58400:58413
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP052759
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP052759_1 346448-346561 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP052759_2 1955199-1955300 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP052759_2 2.1|1955224|52|NZ_CP052759|CRISPRCasFinder 1955224-1955275 52 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63842 0 1.0

1. spacer 2.1|1955224|52|NZ_CP052759|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	CRISPR spacer
tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	Protospacer
****************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 639973 : 722245 88 Pseudomonas_phage(37.5%) holin,tail,tRNA,plate NA
DBSCAN-SWA_2 892656 : 908068 23 Pseudomonas_phage(94.44%) integrase attL 879761:879776|attR 903262:903277
DBSCAN-SWA_3 1256050 : 1292103 41 uncultured_Caudovirales_phage(42.11%) head,tRNA,terminase,portal,integrase,protease,holin attL 1263726:1263742|attR 1277966:1277982
DBSCAN-SWA_4 1299074 : 1314622 14 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_5 1533503 : 1542533 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_6 2422516 : 2473092 65 Pseudomonas_phage(71.15%) tRNA,tail,terminase,integrase,holin attL 2419808:2419825|attR 2451085:2451102
DBSCAN-SWA_7 2677170 : 2684063 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_8 4785479 : 4855307 88 Acidithiobacillus_phage(45.0%) head,tRNA,tail,terminase,capsid,portal NA
DBSCAN-SWA_9 4978867 : 5022528 58 Pseudomonas_phage(92.31%) lysis,transposase,integrase,terminase attL 4968682:4968699|attR 5018578:5018595
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP052759.1|WP_003158163.1|5458933_5459308_+|hypothetical-protein 5458933_5459308_+ 124 aa aa 27 NA NA No NA
NZ_CP052759.1|WP_031635407.1|5461049_5461442_+|hypothetical-protein 5461049_5461442_+ 130 aa aa 3 NA NA No NA
NZ_CP052759.1|WP_003158159.1|5461460_5461784_+|hypothetical-protein 5461460_5461784_+ 107 aa aa 15 NA NA No NA