Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048833 Pseudomonas multiresinivorans strain populi chromosome, complete genome 1 crisprs csa3,DEDDh,DinG,cas3 0 1 9 0

Results visualization

1. NZ_CP048833
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048833_1 5790378-5790508 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048833_1 1.2|5790464|22|NZ_CP048833|CRISPRCasFinder 5790464-5790485 22 NC_022235 Sphingomonas sp. ERG5 plasmid pCADAB1, complete sequence 64449-64470 3 0.864

1. spacer 1.2|5790464|22|NZ_CP048833|CRISPRCasFinder matches to NC_022235 (Sphingomonas sp. ERG5 plasmid pCADAB1, complete sequence) position: , mismatch: 3, identity: 0.864

ttcagtctggctggccttggtt	CRISPR spacer
ttcagtctggctggccttgaca	Protospacer
*******************.. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 62888 : 86843 22 Lactococcus_phage(20.0%) transposase,protease,tRNA NA
DBSCAN-SWA_2 607984 : 672318 59 Bacillus_virus(30.0%) protease,holin,tRNA NA
DBSCAN-SWA_3 1704857 : 1718743 13 Pseudomonas_phage(77.78%) capsid,integrase attL 1697624:1697670|attR 1720205:1720251
DBSCAN-SWA_4 2258923 : 2268391 14 Pseudomonas_phage(87.5%) capsid NA
DBSCAN-SWA_5 2338923 : 2348697 14 Pseudomonas_phage(33.33%) tail,integrase attL 2333485:2333500|attR 2344552:2344567
DBSCAN-SWA_6 2355117 : 2385610 43 Pseudomonas_phage(40.0%) terminase,capsid NA
DBSCAN-SWA_7 3202621 : 3205783 6 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_8 4878292 : 4917267 62 Pseudomonas_phage(25.71%) terminase,tail,holin,tRNA,protease,integrase attL 4889877:4889893|attR 4917612:4917628
DBSCAN-SWA_9 6448934 : 6482882 39 Pseudomonas_phage(27.27%) plate,holin,tail,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage