Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053028 Pseudomonas aeruginosa PAO1 chromosome, complete genome 2 crisprs csa3,DEDDh,cas3,DinG,WYL,RT 0 1 5 0

Results visualization

1. NZ_CP053028
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053028_1 343146-343259 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053028_2 5868627-5868827 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053028_2 2.2|5868783|23|NZ_CP053028|PILER-CR 5868783-5868805 23 AP014204 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S42-C31, *** SEQUENCING IN PROGRESS *** 32703-32725 2 0.913
NZ_CP053028_2 2.2|5868783|23|NZ_CP053028|PILER-CR 5868783-5868805 23 AP014203 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S35-C25, *** SEQUENCING IN PROGRESS *** 10290-10312 2 0.913

1. spacer 2.2|5868783|23|NZ_CP053028|PILER-CR matches to AP014204 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S42-C31, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 2, identity: 0.913

tcgcggccgcggatttcgccaca	CRISPR spacer
tcgcggccgatgatttcgccaca	Protospacer
*********  ************

2. spacer 2.2|5868783|23|NZ_CP053028|PILER-CR matches to AP014203 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S35-C25, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 2, identity: 0.913

tcgcggccgcggatttcgccaca	CRISPR spacer
tcgcggccgatgatttcgccaca	Protospacer
*********  ************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 639315 : 721556 88 Pseudomonas_phage(39.02%) tail,tRNA,plate NA
DBSCAN-SWA_2 1455235 : 1464264 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 2561131 : 2568025 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_4 4719051 : 4726468 9 Pseudomonas_phage(100.0%) integrase,coat attL 4718081:4718107|attR 4730491:4730517
DBSCAN-SWA_5 5156519 : 5194314 38 Pseudomonas_phage(57.14%) integrase,tRNA,coat attL 5182652:5182667|attR 5188185:5188200
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage