Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053086 Pelagibacterium halotolerans strain ANSP101 chromosome, complete genome 3 crisprs RT,csa3,DinG,WYL,cas3 1 1 3 0

Results visualization

1. NZ_CP053086
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053086_1 449249-449329 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053086_2 2953813-2953957 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053086_3 3467063-3467156 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053086_3 3.1|3467096|28|NZ_CP053086|CRISPRCasFinder 3467096-3467123 28 NZ_CP053086.1 3467036-3467063 0 1.0

1. spacer 3.1|3467096|28|NZ_CP053086|CRISPRCasFinder matches to position: 3467036-3467063, mismatch: 0, identity: 1.0

cggtgctttgctggtcgcgcttccgaac	CRISPR spacer
cggtgctttgctggtcgcgcttccgaac	Protospacer
****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053086_3 3.1|3467096|28|NZ_CP053086|CRISPRCasFinder 3467096-3467123 28 NZ_CP054609 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed1, complete sequence 157031-157058 5 0.821

1. spacer 3.1|3467096|28|NZ_CP053086|CRISPRCasFinder matches to NZ_CP054609 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cggtgctttgctggtcgcgcttccgaac	CRISPR spacer
cggtggtttgctggttgcgcttctcatc	Protospacer
***** *********.*******. * *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1948131 : 1959895 12 uncultured_Mediterranean_phage(88.89%) tRNA NA
DBSCAN-SWA_2 1998417 : 2007086 8 Mycobacterium_phage(16.67%) tRNA NA
DBSCAN-SWA_3 2680006 : 2731211 73 Rhodobacter_phage(34.38%) head,terminase,tail,integrase,protease,portal,transposase,capsid attL 2673237:2673252|attR 2715599:2715614
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage