Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047298 Vibrio cholerae O1 biovar El Tor strain C6709 chromosome 2, complete sequence 0 crisprs PD-DExK,csa3,cas3 0 0 0 0
NZ_CP047297 Vibrio cholerae O1 biovar El Tor strain C6709 chromosome 1, complete sequence 1 crisprs cas3,RT,DEDDh,DinG,csx1,WYL,csa3 0 1 7 0

Results visualization

1. NZ_CP047297
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047297_1 2654001-2654244 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047297_1 1.1|2654050|37|NZ_CP047297|PILER-CR 2654050-2654086 37 NC_049942 Escherichia phage JLK-2012, complete sequence 23524-23560 4 0.892
NZ_CP047297_1 1.1|2654050|37|NZ_CP047297|PILER-CR 2654050-2654086 37 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35464 4 0.892

1. spacer 1.1|2654050|37|NZ_CP047297|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
caggtcgccagttcgattccggtagccggcaccatat	Protospacer
.*********************.***********. *

2. spacer 1.1|2654050|37|NZ_CP047297|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
taggtcaccagttcgattccggtagccggcaccaatc	Protospacer
******.***************.*********** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 658179 : 664796 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 1489408 : 1497135 9 Rhizobium_phage(14.29%) NA NA
DBSCAN-SWA_3 1501790 : 1511532 12 Vibrio_phage(42.86%) head,protease,capsid,portal,tail,terminase NA
DBSCAN-SWA_4 1555789 : 1588407 24 Vibrio_phage(47.37%) coat NA
DBSCAN-SWA_5 2327403 : 2334596 9 Anguillid_herpesvirus(16.67%) NA NA
DBSCAN-SWA_6 2566224 : 2573448 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_7 2579617 : 2588235 7 Vibrio_phage(33.33%) integrase,tRNA,transposase attL 2580497:2580509|attR 2587144:2587156
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage