Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP038515 Aeromonas sp. 1805 chromosome, complete genome 12 crisprs csa3,DEDDh,cas3,WYL,RT,DinG,PD-DExK 0 1 3 0

Results visualization

1. NZ_CP038515
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_1 203888-203998 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_2 428069-428166 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_3 772773-772866 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_4 789426-789530 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_5 849199-849346 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_6 887461-887615 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_7 1256656-1256765 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_8 1269361-1269482 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_9 2043515-2043636 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_10 2107360-2107502 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_11 3004522-3004611 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP038515_12 4730858-4730959 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP038515_3 3.1|772804|32|NZ_CP038515|CRISPRCasFinder 772804-772835 32 CP035920 Vibrio cidicii strain 2423-01 plasmid unnamed1, complete sequence 8649-8680 9 0.719

1. spacer 3.1|772804|32|NZ_CP038515|CRISPRCasFinder matches to CP035920 (Vibrio cidicii strain 2423-01 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aagccagccggccccataagccatcgcctgcc	CRISPR spacer
gagcaagcccgccccataagccattcggagct	Protospacer
.*** **** **************.    **.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 484531 : 492066 8 Staphylococcus_phage(50.0%) protease NA
DBSCAN-SWA_2 2396573 : 2406509 10 uncultured_Mediterranean_phage(25.0%) tRNA NA
DBSCAN-SWA_3 3531377 : 3567834 29 Cronobacter_phage(12.5%) plate,protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage