Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053283 Escherichia coli strain SCU-308 plasmid pSCU-308-2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP053282 Escherichia coli strain SCU-308 plasmid pSCU-308-1, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP053281 Escherichia coli strain SCU-308 chromosome, complete genome 6 crisprs csa3,PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,c2c9_V-U4,RT 0 10 6 0

Results visualization

1. NZ_CP053282
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262 : 71305 47 Escherichia_phage(15.79%) integrase,transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053281
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053281_1 630997-631114 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053281_2 1084346-1085167 TypeI-E I-E
13 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053281_3 1100672-1101433 TypeI-E I-E
12 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053281_4 2322495-2322618 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053281_5 2945570-2945661 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053281_6 4144952-4145039 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053281_5 5.1|2945596|40|NZ_CP053281|CRISPRCasFinder 2945596-2945635 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP053281_4 4.1|2322538|38|NZ_CP053281|CRISPRCasFinder 2322538-2322575 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP019314 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence 71972-72003 6 0.812
NZ_CP053281_6 6.1|4144979|34|NZ_CP053281|CRISPRCasFinder 4144979-4145012 34 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 117451-117484 6 0.824
NZ_CP053281_2 2.17|1084802|32|NZ_CP053281|CRISPRCasFinder,CRT 1084802-1084833 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 555773-555804 7 0.781
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 66681-66712 7 0.781
NZ_CP053281_2 2.22|1085107|32|NZ_CP053281|CRISPRCasFinder,CRT 1085107-1085138 32 MK249151 Blackfly microvirus SF02 isolate 049, complete genome 1908-1939 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 46007-46038 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 125777-125808 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 134655-134686 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 68724-68755 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 166140-166171 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 103164-103195 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 36015-36046 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 125777-125808 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 103085-103116 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 103164-103195 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 103163-103194 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 103161-103192 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 103161-103192 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 103085-103116 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 92301-92332 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 100863-100894 9 0.719
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 97248-97279 9 0.719
NZ_CP053281_3 3.3|1100823|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100823-1100854 32 NZ_CP033139 Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence 115828-115859 9 0.719
NZ_CP053281_3 3.3|1100823|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100823-1100854 32 KY579375 Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome 4523-4554 9 0.719
NZ_CP053281_3 3.3|1100823|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100823-1100854 32 EU030939 Sulfolobus spindle-shaped virus 5, complete genome 8793-8824 9 0.719
NZ_CP053281_3 3.3|1100823|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100823-1100854 32 JF412294 EBPR podovirus 1, partial sequence 3991-4022 9 0.719
NZ_CP053281_3 3.5|1100945|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100945-1100976 32 AP014927 Ralstonia phage RSF1 DNA, complete genome 171005-171036 9 0.719
NZ_CP053281_2 2.21|1085046|32|NZ_CP053281|CRISPRCasFinder,CRT 1085046-1085077 32 NZ_CP039902 Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence 33041-33072 10 0.688
NZ_CP053281_2 2.21|1085046|32|NZ_CP053281|CRISPRCasFinder,CRT 1085046-1085077 32 NZ_CP039893 Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence 217865-217896 10 0.688
NZ_CP053281_2 2.21|1085046|32|NZ_CP053281|CRISPRCasFinder,CRT 1085046-1085077 32 NZ_KY000025 Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence 208000-208031 10 0.688
NZ_CP053281_2 2.21|1085046|32|NZ_CP053281|CRISPRCasFinder,CRT 1085046-1085077 32 NZ_KY000029 Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence 208000-208031 10 0.688
NZ_CP053281_2 2.22|1085107|32|NZ_CP053281|CRISPRCasFinder,CRT 1085107-1085138 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 450688-450719 10 0.688
NZ_CP053281_3 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT 1100762-1100793 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1679246-1679277 10 0.688
NZ_CP053281_2 2.14|1084619|32|NZ_CP053281|CRISPRCasFinder,CRT 1084619-1084650 32 NZ_AP018282 Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome 109485-109516 11 0.656

1. spacer 5.1|2945596|40|NZ_CP053281|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

gcgctgcgggtcattcttgaaattccccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
************************ ***************

2. spacer 4.1|2322538|38|NZ_CP053281|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812 

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
gcaccgttctcgcccaacagggcg-acaatctc	Protospacer
 *******.******* ******* ****.*.

4. spacer 6.1|4144979|34|NZ_CP053281|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.824 

ctcgggaatacaccgctgggtgccatctcgattt	CRISPR spacer
ggttggaatacaccgctgggtgccatctcttttt	Protospacer
  . *************************  ***

5. spacer 2.17|1084802|32|NZ_CP053281|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

-gtctgtgatggcctgctcgtgagtccgcggcg	CRISPR spacer
cgcgtg-gatggcctgctcgtcagttcgcgcct	Protospacer
 *. ** ************** ***.**** *

6. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
ccaccgtcttcgccgaccagggca-acgtcctc	Protospacer
*******.****** ********. **. **.

7. spacer 2.22|1085107|32|NZ_CP053281|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719 

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat	Protospacer
  *. *  ***.************* *****

8. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

9. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

10. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

11. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

12. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gcaccgttttcgccgatcagggcggtgacctt	Protospacer
 ************* *.*******   * *..

13. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

14. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

15. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

16. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

17. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

18. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

19. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

20. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

21. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

22. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

23. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

24. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

25. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

26. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

27. spacer 3.3|1100823|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033139 (Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gaaaaagagaatgtagaggaagcgtttttctt	Protospacer
*********** ******.*****   *..

28. spacer 3.3|1100823|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to KY579375 (Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gacaaagagaaagtagagaaagcgattttctt	Protospacer
** ********.************.  *..

29. spacer 3.3|1100823|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to EU030939 (Sulfolobus spindle-shaped virus 5, complete genome) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gacaaagagaaagtagagaaagcgattttctt	Protospacer
** ********.************.  *..

30. spacer 3.3|1100823|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to JF412294 (EBPR podovirus 1, partial sequence) position: , mismatch: 9, identity: 0.719 

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gaaaaagagaaggccgagaaagcagcgaaggc	Protospacer
*************. ********.* .   *

31. spacer 3.5|1100945|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to AP014927 (Ralstonia phage RSF1 DNA, complete genome) position: , mismatch: 9, identity: 0.719 

gcgcaccgttgcgtcgaaaaggcgctggagat	CRISPR spacer
cagacccgtttcgtcgaacaggcgctggcgtg	Protospacer
  *  ***** ******* ********* *

32. spacer 2.21|1085046|32|NZ_CP053281|CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

33. spacer 2.21|1085046|32|NZ_CP053281|CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

34. spacer 2.21|1085046|32|NZ_CP053281|CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

35. spacer 2.21|1085046|32|NZ_CP053281|CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688 

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

36. spacer 2.22|1085107|32|NZ_CP053281|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt	Protospacer
 * ..***** *****.*********** ..

37. spacer 3.2|1100762|32|NZ_CP053281|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
ccaccgtattcgccaaccagggcggcagggaa	Protospacer
******* ****** *********   ..

38. spacer 2.14|1084619|32|NZ_CP053281|CRISPRCasFinder,CRT matches to NZ_AP018282 (Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome) position: , mismatch: 11, identity: 0.656 

acggcgtggattgagggacgggtatttggtcc	CRISPR spacer
gcggagtggattgaggtacgggtaaagaagga	Protospacer
.*** *********** *******   ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1117789 : 1126546 7 Escherichia_phage(71.43%) integrase attL 1124173:1124187|attR 1146935:1146949
DBSCAN-SWA_2 1496652 : 1542244 65 Enterobacteria_phage(31.58%) plate,terminase,holin,lysis NA
DBSCAN-SWA_3 1991190 : 2061243 81 Klebsiella_phage(17.65%) transposase,portal,integrase,holin,protease,head,tail,terminase,capsid attL 1993710:1993769|attR 2033976:2034039
DBSCAN-SWA_4 3108543 : 3184001 48 Escherichia_phage(22.22%) integrase,transposase,holin,protease attL 3162375:3162390|attR 3185924:3185939
DBSCAN-SWA_5 3524095 : 3593062 74 Enterobacteria_phage(57.89%) transposase,portal,integrase,protease,head,tRNA,tail,terminase,capsid,lysis attL 3534309:3534355|attR 3582858:3582904
DBSCAN-SWA_6 3904052 : 3966249 49 Enterobacteria_phage(12.5%) tRNA,transposase,plate,protease NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage