Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053290 Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence 0 crisprs csa3,RT,cas14j 0 0 1 0
NZ_CP053289 Bacillus cereus strain WPySW2 chromosome, complete genome 6 crisprs cas14k,DEDDh,csa3,cas3,RT,WYL,c2c9_V-U4,Cas14u_CAS-V,DinG 1 1 6 0

Results visualization

1. NZ_CP053290
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 318702 : 343187 26 Bacillus_phage(57.14%) integrase,transposase attL 324337:324353|attR 339787:339803
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053289
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053289_1 264891-265024 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053289_2 1126571-1126678 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053289_3 2022877-2022987 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053289_4 2140008-2140158 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053289_5 2588813-2588977 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053289_6 4278260-4278370 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053289_2 2.1|1126597|56|NZ_CP053289|CRISPRCasFinder 1126597-1126652 56 NZ_CP053289.1 1126556-1126611 1 0.982

1. spacer 2.1|1126597|56|NZ_CP053289|CRISPRCasFinder matches to position: 1126556-1126611, mismatch: 1, identity: 0.982

tcgttgatatattgcaagttgtgatagatatatttgaaaaatcgttgatatattgc	CRISPR spacer
tcgttgatatattgtaagttgtgatagatatatttgaaaaatcgttgatatattgc	Protospacer
**************.*****************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053289_1 1.2|264971|31|NZ_CP053289|CRISPRCasFinder 264971-265001 31 JX238501 Bacillus phage phiAGATE, complete genome 124565-124595 8 0.742

1. spacer 1.2|264971|31|NZ_CP053289|CRISPRCasFinder matches to JX238501 (Bacillus phage phiAGATE, complete genome) position: , mismatch: 8, identity: 0.742

atcaacaagcggttcaactagtgacaaaaaa	CRISPR spacer
agtgaagggcggtttaactagtggcaaaaaa	Protospacer
* ..* ..******.********.*******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 968681 : 976367 10 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_2 1809888 : 1820055 15 Bacillus_phage(54.55%) bacteriocin NA
DBSCAN-SWA_3 3479729 : 3488377 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_4 4700744 : 4708702 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_5 5043897 : 5052273 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_6 5097845 : 5105794 6 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage