Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP033361 Mesorhizobium erdmanii strain NZP2014 chromosome, complete genome 2 crisprs WYL,csa3,DinG,DEDDh,cas3,PD-DExK 0 1 3 0

Results visualization

1. NZ_CP033361
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033361_1 3136030-3136123 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033361_2 4742261-4742370 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP033361_1 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder 3136064-3136089 26 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 280709-280734 5 0.808
NZ_CP033361_1 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder 3136064-3136089 26 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 482654-482679 5 0.808
NZ_CP033361_1 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder 3136064-3136089 26 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 641468-641493 5 0.808
NZ_CP033361_1 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder 3136064-3136089 26 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 224557-224582 5 0.808
NZ_CP033361_1 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder 3136064-3136089 26 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 383188-383213 5 0.808
NZ_CP033361_1 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder 3136064-3136089 26 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 440251-440276 5 0.808
NZ_CP033361_1 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder 3136064-3136089 26 MH133207 Acinetobacter phage vB_AbaM_B9, complete genome 9024-9049 6 0.769

1. spacer 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 5, identity: 0.808

cttctttgtttcatgcaagtagttgg	CRISPR spacer
tttctttgtttcatgtaagtagtata	Protospacer
.**************.*******  .

2. spacer 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 5, identity: 0.808

cttctttgtttcatgcaagtagttgg	CRISPR spacer
gctctttgtttcatgcatgtcgttga	Protospacer
 .*************** ** ****.

3. spacer 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.808

cttctttgtttcatgcaagtagttgg	CRISPR spacer
gctctttgtttcatgcatgtcgttga	Protospacer
 .*************** ** ****.

4. spacer 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 5, identity: 0.808

cttctttgtttcatgcaagtagttgg	CRISPR spacer
gctctttgtttcatgcatgtcgttgc	Protospacer
 .*************** ** **** 

5. spacer 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 5, identity: 0.808

cttctttgtttcatgcaagtagttgg	CRISPR spacer
gctctttgtttcatgcatgtcgttgc	Protospacer
 .*************** ** **** 

6. spacer 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

cttctttgtttcatgcaagtagttgg	CRISPR spacer
gctctttgtttcatgcatgtcgttga	Protospacer
 .*************** ** ****.

7. spacer 1.1|3136064|26|NZ_CP033361|CRISPRCasFinder matches to MH133207 (Acinetobacter phage vB_AbaM_B9, complete genome) position: , mismatch: 6, identity: 0.769

cttctttgtttcatgcaagtagttgg	CRISPR spacer
attctttgtttcatgcaagtacactt	Protospacer
 ********************  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3647766 : 3656012 9 uncultured_Mediterranean_phage(85.71%) tRNA NA
DBSCAN-SWA_2 6170207 : 6301031 96 Klosneuvirus(13.33%) tRNA,transposase,integrase attL 6208843:6208902|attR 6256959:6256976
DBSCAN-SWA_3 6394401 : 6450632 36 Acidithiobacillus_phage(22.22%) transposase,integrase attL 6405345:6405360|attR 6452412:6452427
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage