Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP033364 Mesorhizobium sp. NZP2234 chromosome, complete genome 3 crisprs csa3,DEDDh,WYL,PD-DExK,cas3,DinG 0 2 3 0

Results visualization

1. NZ_CP033364
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033364_1 386827-386918 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033364_2 4552088-4552175 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033364_3 6745186-6745282 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 102042-102066 3 0.88
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 713433-713457 3 0.88
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 199727-199751 3 0.88
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 674007-674031 3 0.88
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 565944-565968 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 97299-97323 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 592330-592354 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 389445-389469 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1049462-1049486 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP020897 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP021026 Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence 95-119 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 495329-495353 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013597 Rhizobium sp. N741 plasmid pRspN741b, complete sequence 16-40 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013559 Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013576 Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013548 Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013528 Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013533 Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013538 Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013543 Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013501 Rhizobium esperanzae strain N561 plasmid pRspN561a, complete sequence 16-40 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013581 Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013507 Rhizobium sp. N1341 plasmid pRspN1341b, complete sequence 16-40 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013518 Rhizobium sp. N113 plasmid pRspN113a, complete sequence 16-40 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013570 Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence 113-137 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013491 Rhizobium sp. N6212 plasmid pRspN6212a, complete sequence 16-40 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013513 Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence 16-40 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013496 Rhizobium sp. N621 plasmid pRspN621a, complete sequence 16-40 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013591 Rhizobium sp. N871 plasmid pRspN871a, complete sequence 16-40 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP013603 Rhizobium sp. N731 plasmid pRspN731b, complete sequence 16-40 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 103414-103438 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1988931-1988955 4 0.84
NZ_CP033364_3 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder 6745222-6745246 25 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1398235-1398259 4 0.84
NZ_CP033364_1 1.1|386856|34|NZ_CP033364|CRISPRCasFinder 386856-386889 34 NZ_CP011521 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-4, complete sequence 33915-33948 5 0.853
NZ_CP033364_1 1.1|386856|34|NZ_CP033364|CRISPRCasFinder 386856-386889 34 MN585989 Mycobacterium phage Superchunk, complete genome 23548-23581 6 0.824
NZ_CP033364_1 1.1|386856|34|NZ_CP033364|CRISPRCasFinder 386856-386889 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1245275-1245308 8 0.765
NZ_CP033364_1 1.1|386856|34|NZ_CP033364|CRISPRCasFinder 386856-386889 34 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 72352-72385 8 0.765
NZ_CP033364_1 1.1|386856|34|NZ_CP033364|CRISPRCasFinder 386856-386889 34 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 284629-284662 9 0.735
NZ_CP033364_1 1.1|386856|34|NZ_CP033364|CRISPRCasFinder 386856-386889 34 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 267839-267872 10 0.706
NZ_CP033364_1 1.1|386856|34|NZ_CP033364|CRISPRCasFinder 386856-386889 34 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 129069-129102 10 0.706
NZ_CP033364_1 1.1|386856|34|NZ_CP033364|CRISPRCasFinder 386856-386889 34 KX641264 Mycobacterium phage LindNT, complete genome 56900-56933 11 0.676

1. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 3, identity: 0.88

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttgcgcatgtcgttgccgca	Protospacer
  ******************** **

2. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 3, identity: 0.88

gttttttgcgcatgtcgttgcccca	CRISPR spacer
gttttttaagcatgtcgttgccccg	Protospacer
*******. ***************.

3. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 3, identity: 0.88

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tttctttacgcatgtcgttgcccca	Protospacer
 **.***.*****************

4. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 3, identity: 0.88

gttttttgcgcatgtcgttgcccca	CRISPR spacer
gttttttaagcatgtcgttgccccg	Protospacer
*******. ***************.

5. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttgcgcatgtcggtgccgca	Protospacer
  *************** **** **

6. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tggttttgcgcatgtcgttgccgca	Protospacer
   ******************* **

7. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttgtgcgtgtcgttgcccca	Protospacer
  ******.**.*************

8. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

9. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tttttttaagcatgtcgttgccccg	Protospacer
 ******. ***************.

10. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP020897 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

11. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

12. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgttttttcgcatgtcgttgccgca	Protospacer
  ***** ************** **

13. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

14. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013597 (Rhizobium sp. N741 plasmid pRspN741b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

15. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

16. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

17. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

18. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

19. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

20. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

21. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

22. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

23. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013501 (Rhizobium esperanzae strain N561 plasmid pRspN561a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

24. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

25. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013507 (Rhizobium sp. N1341 plasmid pRspN1341b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

26. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013518 (Rhizobium sp. N113 plasmid pRspN113a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

27. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

28. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013491 (Rhizobium sp. N6212 plasmid pRspN6212a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

29. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013513 (Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

30. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013496 (Rhizobium sp. N621 plasmid pRspN621a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

31. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013591 (Rhizobium sp. N871 plasmid pRspN871a, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

32. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP013603 (Rhizobium sp. N731 plasmid pRspN731b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttacgcatgtcgttgccgca	Protospacer
  *****.************** **

33. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttgcgcatgtcattgccgca	Protospacer
  **************.***** **

34. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
tgtttttgcgcatgtcgttgtcgca	Protospacer
  ******************.* **

35. spacer 3.1|6745222|25|NZ_CP033364|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 4, identity: 0.84

gttttttgcgcatgtcgttgcccca	CRISPR spacer
gttttttaagcatgtcgttgcccgc	Protospacer
*******. **************  

36. spacer 1.1|386856|34|NZ_CP033364|CRISPRCasFinder matches to NZ_CP011521 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-4, complete sequence) position: , mismatch: 5, identity: 0.853

ggcgatg-cgccgccggccaagccggcgacaccgg	CRISPR spacer
-gcggtgccgctgccggccaagccggcgacacccc	Protospacer
 ***.** ***.*********************  

37. spacer 1.1|386856|34|NZ_CP033364|CRISPRCasFinder matches to MN585989 (Mycobacterium phage Superchunk, complete genome) position: , mismatch: 6, identity: 0.824

ggcgat-gcgccgccggccaagccggcgacaccgg	CRISPR spacer
-gcgccagcgccgccggccaagccggtgaaaccga	Protospacer
 *** . *******************.** ****.

38. spacer 1.1|386856|34|NZ_CP033364|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.765

ggcgatgcgccgccggccaagccggcgacaccgg	CRISPR spacer
gccgatgcgccgccggccaagctggcgttctacg	Protospacer
* ********************.**** . .  *

39. spacer 1.1|386856|34|NZ_CP033364|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 8, identity: 0.765

ggcga-tgcgccgccggccaagccggcgacaccgg	CRISPR spacer
-tcgaccgcgccgccggcatagccggcgacaaggc	Protospacer
  *** .***********  ***********  * 

40. spacer 1.1|386856|34|NZ_CP033364|CRISPRCasFinder matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ggcgatgcgccgccggccaagccggcgacaccgg	CRISPR spacer
cacgatgcgcggacggccaagccggctgccgcgc	Protospacer
 .******** * ************* .*  ** 

41. spacer 1.1|386856|34|NZ_CP033364|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 10, identity: 0.706

ggcgatgcgccgccggccaagccggcgacaccgg	CRISPR spacer
ccggatgcgccgcccgccgagccggcgctgcgtg	Protospacer
   *********** ***.******** ..*  *

42. spacer 1.1|386856|34|NZ_CP033364|CRISPRCasFinder matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 10, identity: 0.706

ggcgatgcgccgccggccaagccggcgacaccgg	CRISPR spacer
ccgcctacaccgccgcccgagccggcgacaccgc	Protospacer
     *.*.****** **.************** 

43. spacer 1.1|386856|34|NZ_CP033364|CRISPRCasFinder matches to KX641264 (Mycobacterium phage LindNT, complete genome) position: , mismatch: 11, identity: 0.676

ggcgatgcgccgccggccaagccggcgacaccgg	CRISPR spacer
ctacctgcgccgacggccaggccggcgacctttg	Protospacer
     ******* ******.********* .. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3479659 : 3491578 12 Bordetella_phage(25.0%) NA NA
DBSCAN-SWA_2 3503107 : 3574255 74 Acidithiobacillus_phage(31.82%) portal,plate,tRNA,integrase,head,capsid,tail,terminase attL 3531643:3531660|attR 3537835:3537852
DBSCAN-SWA_3 3784241 : 3792427 9 uncultured_Mediterranean_phage(85.71%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage