Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP030944 Arcobacter aquimarinus strain W63 chromosome, complete genome 3 crisprs cas6,PrimPol,DEDDh,csa3,cas3,WYL 1 0 6 0

Results visualization

1. NZ_CP030944
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030944_1 15755-15879 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030944_2 363795-363890 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030944_3 1866014-1866248 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP030944_3 3.2|1866183|49|NZ_CP030944|PILER-CR 1866183-1866231 49 NZ_CP030944.1 1865965-1866013 0 1.0

1. spacer 3.2|1866183|49|NZ_CP030944|PILER-CR matches to position: 1865965-1866013, mismatch: 0, identity: 1.0

aaatattaatattaaaatcattttttcattaaatgtaatgctaaaatat	CRISPR spacer
aaatattaatattaaaatcattttttcattaaatgtaatgctaaaatat	Protospacer
*************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 494836 : 503173 10 Indivirus(33.33%) NA NA
DBSCAN-SWA_2 940553 : 948932 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 1394852 : 1468716 93 Campylobacter_phage(12.0%) tail,tRNA,plate,head,integrase,transposase,holin,capsid attL 1431609:1431625|attR 1463481:1463497
DBSCAN-SWA_4 2201523 : 2208456 9 Campylobacter_virus(33.33%) tRNA NA
DBSCAN-SWA_5 2242221 : 2252628 8 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_6 2473138 : 2481208 9 Staphylococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage