Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053746 Pseudomonas graminis strain PgKB30 chromosome, complete genome 5 crisprs DinG,DEDDh,csa3,cas3 1 0 2 0

Results visualization

1. NZ_CP053746
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053746_1 364655-364755 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053746_2 2305753-2305826 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053746_3 3512776-3512883 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053746_4 3702865-3702951 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053746_5 5337538-5337647 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053746_4 4.1|3702889|39|NZ_CP053746|CRISPRCasFinder 3702889-3702927 39 NZ_CP053746.1 3703022-3703060 2 0.949

1. spacer 4.1|3702889|39|NZ_CP053746|CRISPRCasFinder matches to position: 3703022-3703060, mismatch: 2, identity: 0.949

aggttcgccagtcccactgggggtacgcggtcgattagt	CRISPR spacer
aggtttgccagtcccactgggggtacgcgatcgattagt	Protospacer
*****.***********************.*********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3409876 : 3425007 19 uncultured_Caudovirales_phage(53.85%) holin,tRNA,bacteriocin NA
DBSCAN-SWA_2 4186721 : 4261427 90 Pseudomonas_phage(43.64%) tail,terminase,lysis,transposase,capsid,integrase attL 4186533:4186558|attR 4243250:4243275
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage