Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053853 Propionibacterium freudenreichii strain FAM 14217 chromosome, complete genome 3 crisprs DEDDh,csa3,cas3,WYL,DinG 0 4 4 0

Results visualization

1. NZ_CP053853
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053853_1 180542-180636 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053853_2 784284-784448 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053853_3 2546926-2547465 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053853_2 2.1|784308|21|NZ_CP053853|CRISPRCasFinder 784308-784328 21 NZ_CP035418 Leisingera sp. NJS204 plasmid unnamed1, complete sequence 24862-24882 1 0.952
NZ_CP053853_2 2.1|784308|21|NZ_CP053853|CRISPRCasFinder 784308-784328 21 NZ_CP041156 Leisingera aquaemixtae strain R2C4 plasmid unnamed1, complete sequence 73773-73793 1 0.952
NZ_CP053853_2 2.1|784308|21|NZ_CP053853|CRISPRCasFinder 784308-784328 21 NZ_CP038237 Leisingera sp. NJS201 plasmid unnamed3, complete sequence 106383-106403 1 0.952
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 47914-47937 2 0.917
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 NZ_AP017656 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence 121074-121097 2 0.917
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 NZ_CP018821 Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence 296836-296859 2 0.917
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 MH444512 Bifidobacterium phage Willi, complete genome 3528-3551 2 0.917
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 MK932884 Bifidobacterium phage PMBT6, complete genome 3528-3551 2 0.917
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 499907-499930 3 0.875
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 NZ_AP014707 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_3p, complete sequence 49875-49898 3 0.875
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 32428-32451 3 0.875
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 71885-71908 3 0.875
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 KC170282 Uncultured bacterium plasmid pMBUI6, complete sequence 3102-3125 3 0.875
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 GQ919031 Streptomyces phage ZL12, complete genome 49155-49178 3 0.875
NZ_CP053853_2 2.3|784401|24|NZ_CP053853|CRISPRCasFinder 784401-784424 24 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 1387809-1387832 3 0.875
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 NZ_CP054842 Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence 106401-106424 4 0.833
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 415999-416022 4 0.833
NZ_CP053853_2 2.2|784353|24|NZ_CP053853|CRISPRCasFinder 784353-784376 24 MT939492 Xanthomonas phage Xoo-sp14, complete genome 230325-230348 4 0.833
NZ_CP053853_3 3.1|2546962|36|NZ_CP053853|PILER-CR,CRISPRCasFinder,CRT 2546962-2546997 36 NZ_CP015734 Arthrobacter sp. U41 plasmid unnamed2, complete sequence 99431-99466 8 0.778

1. spacer 2.1|784308|21|NZ_CP053853|CRISPRCasFinder matches to NZ_CP035418 (Leisingera sp. NJS204 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

cgcaccacccgcaaggcgacg	CRISPR spacer
cgcaccacccgcaaggtgacg	Protospacer
****************.****

2. spacer 2.1|784308|21|NZ_CP053853|CRISPRCasFinder matches to NZ_CP041156 (Leisingera aquaemixtae strain R2C4 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

cgcaccacccgcaaggcgacg	CRISPR spacer
cgcaccacccgcaaggtgacg	Protospacer
****************.****

3. spacer 2.1|784308|21|NZ_CP053853|CRISPRCasFinder matches to NZ_CP038237 (Leisingera sp. NJS201 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.952

cgcaccacccgcaaggcgacg	CRISPR spacer
cgcaccacccgcaaggtgacg	Protospacer
****************.****

4. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

aagccggcggccaagaagccggca	CRISPR spacer
aaaccggcggccaagaagcctgca	Protospacer
**.***************** ***

5. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 2, identity: 0.917

aagccggcggccaagaagccggca	CRISPR spacer
aagccggccgccaagaagcccgca	Protospacer
******** *********** ***

6. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 2, identity: 0.917

aagccggcggccaagaagccggca	CRISPR spacer
aagccggccgccaagaagcccgca	Protospacer
******** *********** ***

7. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to MH444512 (Bifidobacterium phage Willi, complete genome) position: , mismatch: 2, identity: 0.917

aagccggcggccaagaagccggca	CRISPR spacer
aagccggcggaaaagaagccggca	Protospacer
**********  ************

8. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to MK932884 (Bifidobacterium phage PMBT6, complete genome) position: , mismatch: 2, identity: 0.917

aagccggcggccaagaagccggca	CRISPR spacer
aagccggcggaaaagaagccggca	Protospacer
**********  ************

9. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 3, identity: 0.875

aagccggcggccaagaagccggca	CRISPR spacer
aagccggcggcaaataagccggcg	Protospacer
*********** ** ********.

10. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to NZ_AP014707 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_3p, complete sequence) position: , mismatch: 3, identity: 0.875

aagccggcggccaagaagccggca	CRISPR spacer
aagccggcgaccgagaagccggcg	Protospacer
*********.**.**********.

11. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 3, identity: 0.875

aagccggcggccaagaagccggca	CRISPR spacer
aaggcggcgaccaagaagccggcc	Protospacer
*** *****.************* 

12. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccggcggccaagaagccggca	CRISPR spacer
aagccagcggtcaagaagccggcg	Protospacer
*****.****.************.

13. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to KC170282 (Uncultured bacterium plasmid pMBUI6, complete sequence) position: , mismatch: 3, identity: 0.875

aagccggcggccaagaagccggca	CRISPR spacer
aagcccgcagccaagaagccggct	Protospacer
***** **.************** 

14. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to GQ919031 (Streptomyces phage ZL12, complete genome) position: , mismatch: 3, identity: 0.875

aagccggcggccaagaagccggca	CRISPR spacer
aagaccgcggccaagaagccggcc	Protospacer
*** * ***************** 

15. spacer 2.3|784401|24|NZ_CP053853|CRISPRCasFinder matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 3, identity: 0.875

acggcgtccacggccaagccggca	CRISPR spacer
tcggcgtcgacggcgaagccggca	Protospacer
 ******* ***** *********

16. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.833

aagccggcggccaagaagccggca	CRISPR spacer
gattcggcggccaagaagccggcc	Protospacer
.* .******************* 

17. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

aagccggcggccaagaagccggca	CRISPR spacer
gagccgccggccaagaagccggtt	Protospacer
.***** ***************. 

18. spacer 2.2|784353|24|NZ_CP053853|CRISPRCasFinder matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 4, identity: 0.833

aagccggcggccaagaagccggca	CRISPR spacer
aagccggctgccaagaagccgctg	Protospacer
******** ************ ..

19. spacer 3.1|2546962|36|NZ_CP053853|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015734 (Arthrobacter sp. U41 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.778

agcgcatgggagaaggcccggcaggacgccgtggac	CRISPR spacer
gccgccacggacaaggcccggcaggacgccctggag	Protospacer
. ***   *** ****************** **** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1034 : 86650 76 Propionibacterium_phage(55.17%) protease,tRNA,integrase,transposase attL 4968:4983|attR 89492:89507
DBSCAN-SWA_2 197994 : 267050 55 Tupanvirus(13.33%) holin,tRNA,transposase NA
DBSCAN-SWA_3 526810 : 545300 19 Mycobacterium_phage(33.33%) integrase,transposase attL 540865:540882|attR 543879:543896
DBSCAN-SWA_4 2606253 : 2632753 37 Propionibacterium_phage(100.0%) holin,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage