Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048104 Kroppenstedtia pulmonis strain W9323 chromosome, complete genome 10 crisprs cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7,csa3,WYL,DEDDh,cas3,cas6,cas4,cas14j,RT 0 1 3 0

Results visualization

1. NZ_CP048104
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048104_2 1038192-1038356 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048104_1 1037287-1037584 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048104_3 1068207-1068637 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048104_4 1069585-1070085 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048104_5 1698788-1699015 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048104_6 1702851-1703148 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048104_7 2735034-2735195 TypeI-A NA
2 spacers
csa3,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048104_8 2736934-2737102 TypeI-A NA
2 spacers
cas6,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048104_10 2738482-2738742 TypeI-A NA
3 spacers
cas6,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048104_9 2737671-2738070 TypeI-A NA
5 spacers
cas6,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048104_5 5.2|1698883|37|NZ_CP048104|PILER-CR,CRISPRCasFinder,CRT 1698883-1698919 37 KX507046 Vibrio phage S4-7, complete genome 35559-35595 9 0.757

1. spacer 5.2|1698883|37|NZ_CP048104|PILER-CR,CRISPRCasFinder,CRT matches to KX507046 (Vibrio phage S4-7, complete genome) position: , mismatch: 9, identity: 0.757

gttggtctgcggtgaaatgttccatcatctcagctat	CRISPR spacer
cctcttgtgcggtggagtgttccatcatctcagcaaa	Protospacer
 .*  * *******.*.***************** * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 531878 : 541853 9 Synechococcus_phage(37.5%) NA NA
DBSCAN-SWA_2 867754 : 880104 10 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_3 1493723 : 1506572 14 Staphylococcus_phage(40.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage