Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP054018 Rothia dentocariosa strain FDAARGOS_752 chromosome, complete genome 3 crisprs csa3,DinG,DEDDh,WYL,c2c9_V-U4 1 0 2 0

Results visualization

1. NZ_CP054018
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054018_1 596027-596099 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054018_2 1624601-1624684 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054018_3 2263176-2263387 TypeV-U4 NA
3 spacers
c2c9_V-U4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP054018_2 2.1|1624625|36|NZ_CP054018|CRISPRCasFinder 1624625-1624660 36 NZ_CP054018.1 1624685-1624720 1 0.972

1. spacer 2.1|1624625|36|NZ_CP054018|CRISPRCasFinder matches to position: 1624685-1624720, mismatch: 1, identity: 0.972

tatcgggagtgtcagggtgatcgctgtcgtgatcac	CRISPR spacer
tatcgggagtgtcagggtgatcactgtcgtgatcac	Protospacer
**********************.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1238351 : 1246823 8 Staphylococcus_phage(16.67%) NA NA
DBSCAN-SWA_2 2228718 : 2272948 42 Gordonia_phage(18.18%) transposase,integrase,tRNA,protease attL 2221299:2221314|attR 2261231:2261246
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage