Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053617 Achromobacter xylosoxidans strain GN050 chromosome, complete genome 7 crisprs csa3,PD-DExK,DEDDh,WYL,cas3,DinG 2 6 3 0

Results visualization

1. NZ_CP053617
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053617_1 1080308-1080382 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053617_3 1080947-1081047 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053617_2 1080593-1080865 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053617_4 2693650-2693757 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053617_5 3511618-3511727 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053617_6 3967605-3967699 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053617_7 4951216-4951325 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP053617_2 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder 1080765-1080787 23 NZ_CP053617.1 1081026-1081048 0 1.0
NZ_CP053617_7 7.1|4951247|48|NZ_CP053617|CRISPRCasFinder 4951247-4951294 48 NZ_CP053617.1 662004-662051 0 1.0

1. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to position: 1081026-1081048, mismatch: 0, identity: 1.0

caacggcggcttgctgggcggcc	CRISPR spacer
caacggcggcttgctgggcggcc	Protospacer
***********************

2. spacer 7.1|4951247|48|NZ_CP053617|CRISPRCasFinder matches to position: 662004-662051, mismatch: 0, identity: 1.0

aagcccccacgctcgccgctgcgcgggtcgctgccccccgagggggcg	CRISPR spacer
aagcccccacgctcgccgctgcgcgggtcgctgccccccgagggggcg	Protospacer
************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053617_2 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder 1080765-1080787 23 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 396957-396979 2 0.913
NZ_CP053617_2 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder 1080765-1080787 23 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 338519-338541 2 0.913
NZ_CP053617_2 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder 1080765-1080787 23 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 651584-651606 2 0.913
NZ_CP053617_2 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder 1080765-1080787 23 KF279411 Mycobacterium phage Adawi, complete genome 24818-24840 2 0.913
NZ_CP053617_2 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder 1080765-1080787 23 NZ_CP049160 Caballeronia sp. SBC1 plasmid pSBC1_4, complete sequence 702-724 2 0.913
NZ_CP053617_2 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder 1080765-1080787 23 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 3171-3193 3 0.87
NZ_CP053617_2 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder 1080765-1080787 23 MT310853 Microbacterium phage AvGardian, complete genome 40370-40392 3 0.87
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 56258-56288 4 0.871
NZ_CP053617_1 1.1|1080331|28|NZ_CP053617|CRISPRCasFinder 1080331-1080358 28 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1386386-1386413 5 0.821
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5448834-5448864 5 0.839
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2752879-2752909 5 0.839
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 185033-185063 5 0.839
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 484969-484999 5 0.839
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 562252-562282 5 0.839
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 CP000663 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence 156499-156529 5 0.839
NZ_CP053617_5 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder 3511659-3511686 28 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 760721-760748 5 0.821
NZ_CP053617_5 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder 3511659-3511686 28 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 720631-720658 5 0.821
NZ_CP053617_5 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder 3511659-3511686 28 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1355300-1355327 5 0.821
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NC_011760 Methylorubrum extorquens CM4 plasmid pCMU02, complete sequence 19685-19715 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_015187 Acidiphilium multivorum AIU301 plasmid pACMV2, complete sequence 62351-62381 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1305377-1305407 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1074596-1074626 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 738530-738560 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 378250-378280 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 658225-658255 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 658260-658290 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 544286-544316 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 314826-314856 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 50717-50747 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 658075-658105 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 40007-40037 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 658053-658083 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 537508-537538 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 9666-9696 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_LR536452 Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 3 105977-106007 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 281288-281318 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 131910-131940 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 132276-132306 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 132429-132459 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 132795-132825 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 133161-133191 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 133527-133557 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 133893-133923 6 0.806
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 71874-71904 6 0.806
NZ_CP053617_5 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder 3511659-3511686 28 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1743332-1743359 6 0.786
NZ_CP053617_1 1.1|1080331|28|NZ_CP053617|CRISPRCasFinder 1080331-1080358 28 X15001 Coliphage 186 l-strand DNA 77.4-79.6% with genes cp76, cp77, cp78, cp79 1031-1058 7 0.75
NZ_CP053617_1 1.1|1080331|28|NZ_CP053617|CRISPRCasFinder 1080331-1080358 28 U32222 Bacteriophage 186, complete sequence 24465-24492 7 0.75
NZ_CP053617_2 2.1|1080616|34|NZ_CP053617|CRISPRCasFinder 1080616-1080649 34 NC_004934 Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence 25870-25903 7 0.794
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1178780-1178810 7 0.774
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1081436-1081466 7 0.774
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1081425-1081455 7 0.774
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_CP053209 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1A, complete sequence 124731-124761 7 0.774
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_CP050084 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b2, complete sequence 101702-101732 7 0.774
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 106599-106629 7 0.774
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 512353-512383 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1898244-1898274 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 369976-370006 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 91012-91042 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 217326-217356 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 82201-82231 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 82201-82231 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 306775-306805 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 144401-144431 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 81599-81629 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1209385-1209415 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 361682-361712 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1451386-1451416 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 81885-81915 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 833869-833899 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 88240-88270 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_015178 Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence 140889-140919 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_009469 Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence 53725-53755 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 MH509441 Mycobacterium phage Acolyte, complete genome 1236-1266 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 364964-364994 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 421411-421441 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 87623-87653 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1339360-1339390 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 190213-190243 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 190214-190244 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 132520-132550 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 402847-402877 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 680556-680586 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 537819-537849 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 354263-354293 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 527975-528005 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 266709-266739 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP025017 Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence 179853-179883 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 515653-515683 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 266893-266923 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP048284 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence 200098-200128 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 141331-141361 7 0.774
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 544697-544727 7 0.774
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_CP011053 Halomonas sp. KO116 plasmid unnamed1, complete sequence 22600-22630 8 0.742
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 894826-894856 8 0.742
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 581989-582019 8 0.742
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NC_015065 Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence 6826-6856 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 88779-88809 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 81222-81252 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 81460-81490 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 49122-49152 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1117944-1117974 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 81148-81178 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 86086-86116 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 86086-86116 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 86086-86116 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 87909-87939 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 86080-86110 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 81460-81490 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1796961-1796991 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 86086-86116 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 81186-81216 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 822770-822800 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 93072-93102 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 125251-125281 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 100172-100202 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1493788-1493818 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 91357-91387 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 101149-101179 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 80890-80920 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1893239-1893269 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1896906-1896936 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 87157-87187 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1752061-1752091 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 7870-7900 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 87157-87187 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 87157-87187 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 87157-87187 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1334780-1334810 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 670621-670651 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 109954-109984 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 536487-536517 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1081531-1081561 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 109952-109982 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1869631-1869661 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 440847-440877 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 101166-101196 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 276173-276203 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1339065-1339095 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 881216-881246 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1291876-1291906 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 126348-126378 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP007214 Burkholderia plantarii strain ATCC 43733 plasmid bpln_1p, complete sequence 139328-139358 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 776439-776469 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1895409-1895439 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 525869-525899 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 174913-174943 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_017078 Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC1, complete sequence 23401-23431 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_007763 Rhizobium etli CFN 42 plasmid p42b, complete sequence 90507-90537 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1368047-1368077 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 373695-373725 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 83769-83799 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 96293-96323 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 253046-253076 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 260670-260700 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP020907 Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence 89630-89660 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1375337-1375367 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 255171-255201 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1546870-1546900 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 260674-260704 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 252985-253015 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1122929-1122959 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 259155-259185 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1670570-1670600 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 649183-649213 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 257008-257038 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1291849-1291879 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 263744-263774 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 260670-260700 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_021906 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence 88540-88570 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1371952-1371982 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1375504-1375534 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1482657-1482687 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 259155-259185 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 252985-253015 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1084297-1084327 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1297969-1297999 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1294695-1294725 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1486038-1486068 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_022599 Micrococcus sp. V7 plasmid pLMV7, complete sequence 37763-37793 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 361940-361970 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1741986-1742016 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1261899-1261929 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 694873-694903 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1386967-1386997 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1486005-1486035 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1349921-1349951 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1386221-1386251 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1484799-1484829 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 251880-251910 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 585143-585173 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1285373-1285403 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1349921-1349951 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1386221-1386251 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1484835-1484865 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1349921-1349951 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1285395-1285425 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1349925-1349955 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1386221-1386251 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1386221-1386251 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1386221-1386251 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1484835-1484865 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 92649-92679 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 668155-668185 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1484824-1484854 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1285395-1285425 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1292233-1292263 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1272894-1272924 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1325759-1325789 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1365898-1365928 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 798940-798970 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1484824-1484854 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1285395-1285425 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1349920-1349950 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1415166-1415196 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1485826-1485856 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1285395-1285425 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1285395-1285425 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1484835-1484865 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1386224-1386254 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 657595-657625 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1484846-1484876 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1484647-1484677 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 657595-657625 8 0.742
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP011869 Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence 238276-238306 8 0.742
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 136181-136211 9 0.71
NZ_CP053617_2 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder 1080673-1080703 31 NZ_CP031163 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence 17247-17277 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1239571-1239601 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 LR606148 Rhizobium sp. Q54 genome assembly, plasmid: 5 180097-180127 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 KU310944 Pseudomonas phage YMC11/06/C171_PPU_BP, complete genome 14785-14815 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 385931-385961 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 434761-434791 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP039912 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence 138526-138556 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NC_008537 Arthrobacter sp. FB24 plasmid 1, complete sequence 116301-116331 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 332239-332269 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 2064377-2064407 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 161416-161446 9 0.71
NZ_CP053617_2 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder 1080811-1080841 31 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 86500-86530 10 0.677
NZ_CP053617_2 2.1|1080616|34|NZ_CP053617|CRISPRCasFinder 1080616-1080649 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 152388-152421 11 0.676

1. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913

caacggcggcttgctgggcggcc	CRISPR spacer
caacggcggcttgctcgccggcc	Protospacer
*************** * *****

2. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.913

caacggcggcttgctgggcggcc	CRISPR spacer
caacggcggctcgctggacggcc	Protospacer
***********.*****.*****

3. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

caacggcggcttgctgggcggcc	CRISPR spacer
caagggcggcctgctgggcggcc	Protospacer
*** ******.************

4. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to KF279411 (Mycobacterium phage Adawi, complete genome) position: , mismatch: 2, identity: 0.913

caacggcggcttgctgggcggcc	CRISPR spacer
catcggcggcttgctgggcagcc	Protospacer
** ****************.***

5. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049160 (Caballeronia sp. SBC1 plasmid pSBC1_4, complete sequence) position: , mismatch: 2, identity: 0.913

caacggcggcttgctgggcggcc	CRISPR spacer
caccggaggcttgctgggcggcc	Protospacer
** *** ****************

6. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.87

caacggcggcttgctgggcggcc	CRISPR spacer
gaacggcggcttgttgggcggct	Protospacer
 ************.********.

7. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to MT310853 (Microbacterium phage AvGardian, complete genome) position: , mismatch: 3, identity: 0.87

caacggcggcttgctgggcggcc	CRISPR spacer
tcacggcggcctgctgggcggcc	Protospacer
. ********.************

8. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.871

-gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
ggcggc-ggcggcaacggcggccggctggctt	Protospacer
 ***** *****.********** *******.

9. spacer 1.1|1080331|28|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ctgacccagcaagtgggcgccaccacca	CRISPR spacer
ctggcccagcaagtgcgcgccacctgga	Protospacer
***.*********** ********   *

10. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.839

gcggcgggcggtaacggcggcctgctggctc-	CRISPR spacer
acggcgggcggcaacggcggcctgc-gccgcg	Protospacer
.**********.************* * * * 

11. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cgcggcggcgcggccggcggcgccacgcggg	Protospacer
  *******.***************** * *

12. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

accggcggcacggccggcggcgcc-acgggcg	CRISPR spacer
gccggcgccacggccggccgcgccgacaggc-	Protospacer
.****** ********** ***** **.*** 

13. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.839

accggcggcacggccggcggcgccacgggcg-	CRISPR spacer
accggcagcacgggcggcggcg-cagggtcgg	Protospacer
******.****** ******** ** ** ** 

14. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 5, identity: 0.839

accggcggcacggccggcggcgccacgggcg-	CRISPR spacer
accggcagcacgggcggcggcg-cagggtcgg	Protospacer
******.****** ******** ** ** ** 

15. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 5, identity: 0.839

accggcggcacggccggcggcgc-cacgggcg	CRISPR spacer
accggcgccacggcccgcggcgcgcgccggc-	Protospacer
******* ******* ******* *.* *** 

16. spacer 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 5, identity: 0.821

tggctttggcttggcgctgccgtggttc	CRISPR spacer
cagcttcggcttgccgctgccgtggtcc	Protospacer
..****.****** ************.*

17. spacer 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 5, identity: 0.821

tggctttggcttggcgctgccgtggttc	CRISPR spacer
cagcttcggcttgccgctgccgtggtcc	Protospacer
..****.****** ************.*

18. spacer 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.821

tggctttggcttggcgctgccgtggttc	CRISPR spacer
cagcttcggcttgccgctgccgtggtcc	Protospacer
..****.****** ************.*

19. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NC_011760 (Methylorubrum extorquens CM4 plasmid pCMU02, complete sequence) position: , mismatch: 6, identity: 0.806

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
acgcagggcggcaacggctgcctgctggcgc	Protospacer
.**  ******.****** ********** *

20. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_015187 (Acidiphilium multivorum AIU301 plasmid pACMV2, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ctgggcggcaaggcgggcggcgccacgggct	Protospacer
 . ******* *** *************** 

21. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ggcggcggcacggccggcgacgcgacggtgg	Protospacer
. *****************.*** ****  *

22. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
acccgcggcccggccggcggcgccgggtccg	Protospacer
*** ***** **************. *  **

23. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
acccgcggcccggccggcggcgccgggtccg	Protospacer
*** ***** **************. *  **

24. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.806

-accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cattcgc-gcacggcctgcggcgccaccggcg	Protospacer
 *.. ** ******** ********** ****

25. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

accggc-ggcacggccggcggcgccacgggcg	CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga	Protospacer
 *** * **** *****************  .

26. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

accggc-ggcacggccggcggcgccacgggcg	CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga	Protospacer
 *** * **** *****************  .

27. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

accggc-ggcacggccggcggcgccacgggcg	CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga	Protospacer
 *** * **** *****************  .

28. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

accggc-ggcacggccggcggcgccacgggcg	CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga	Protospacer
 *** * **** *****************  .

29. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.806

-accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cattcgc-gcacggcctgcggcgccaccggcg	Protospacer
 *.. ** ******** ********** ****

30. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.806

accggc-ggcacggccggcggcgccacgggcg	CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga	Protospacer
 *** * **** *****************  .

31. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accgtcggcccggccggcggcgccgctgtcc	Protospacer
**** **** **************.* * * 

32. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

accggc-ggcacggccggcggcgccacgggcg	CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga	Protospacer
 *** * **** *****************  .

33. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.806

accggc-ggcacggccggcggcgccacgggcg	CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga	Protospacer
 *** * **** *****************  .

34. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
agcgggatcacggtcggcgccgccacgggcg	Protospacer
* *** . *****.***** ***********

35. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_LR536452 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 3) position: , mismatch: 6, identity: 0.806

--accggcggcacggccggcggcgccacgggcg	CRISPR spacer
tcatcgac--cacggccggcggcggcatgggcg	Protospacer
  *.**.*  ************** **.*****

36. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg----	CRISPR spacer
accggcggcggggccggcggcgc----ggcgtcgt	Protospacer
*********. ************    ****    

37. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcgggacggtcggcggcgcgctggccg	Protospacer
******** ****.*********  .** **

38. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcgggacggtcggcggcgcgctggccg	Protospacer
******** ****.*********  .** **

39. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcgggacggtcggcggcgcgctggccg	Protospacer
******** ****.*********  .** **

40. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcgggacggtcggcggcgcgctggccg	Protospacer
******** ****.*********  .** **

41. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcgggacggtcggcggcgcgctggccg	Protospacer
******** ****.*********  .** **

42. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcgggacggtcggcggcgcgctggccg	Protospacer
******** ****.*********  .** **

43. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcgggacggtcggcggcgcgctggccg	Protospacer
******** ****.*********  .** **

44. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
agcgggatcacggtcggcgccgccacgggcg	Protospacer
* *** . *****.***** ***********

45. spacer 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tggctttggcttggcgctgccgtggttc	CRISPR spacer
cccctttggctgggcgctgccgtggtgg	Protospacer
.  ******** **************  

46. spacer 1.1|1080331|28|NZ_CP053617|CRISPRCasFinder matches to X15001 (Coliphage 186 l-strand DNA 77.4-79.6% with genes cp76, cp77, cp78, cp79) position: , mismatch: 7, identity: 0.75

ctgacccagcaagtgggcgccaccacca	CRISPR spacer
agactccagcaagtggtcgccagcacca	Protospacer
  . .*********** ***** *****

47. spacer 1.1|1080331|28|NZ_CP053617|CRISPRCasFinder matches to U32222 (Bacteriophage 186, complete sequence) position: , mismatch: 7, identity: 0.75

ctgacccagcaagtgggcgccaccacca	CRISPR spacer
agactccagcaagtggtcgccagcacca	Protospacer
  . .*********** ***** *****

48. spacer 2.1|1080616|34|NZ_CP053617|CRISPRCasFinder matches to NC_004934 (Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence) position: , mismatch: 7, identity: 0.794

aacaacggcg----gcctgctcagcccgatcaccggca	CRISPR spacer
----tcggcgcacagcttgcacagcccgatcaccggca	Protospacer
     *****    **.*** *****************

49. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.774

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
ccggcgggcggcaagggcggcctgcagtggc	Protospacer
 **********.** ********** *   *

50. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
ccggcgggcggcaagggcggcctgcagtggc	Protospacer
 **********.** ********** *   *

51. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
ccggcgggcggcaagggcggcctgcagtggc	Protospacer
 **********.** ********** *   *

52. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP053209 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1A, complete sequence) position: , mismatch: 7, identity: 0.774

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
gcggcgggcggtcgcggcggcctggcgcagc	Protospacer
************ .********** .*   *

53. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050084 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b2, complete sequence) position: , mismatch: 7, identity: 0.774

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
gcggcgggcggtcgcggcggcctggcgcagc	Protospacer
************ .********** .*   *

54. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
cggggtgccgggaacggcgccctgctggctc	Protospacer
  **  * *** ******* ***********

55. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.774

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
ccggcgggcggtcagggcggcctggagtccc	Protospacer
 *********** * *********  * *.*

56. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ctgctcggcacggccggcggcgccatgggca	Protospacer
 .   ********************.****.

57. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggccggcggcgccatcgatt	Protospacer
.***** ******************. *.. 

58. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggccggcggcgccagcgatt	Protospacer
.***** ******************  *.. 

59. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ggcggcggcacggccggcgacgcgacggttc	Protospacer
. *****************.*** **** . 

60. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggccggcggcgccatcgatt	Protospacer
.***** ******************. *.. 

61. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggccggcggcgccatcgatt	Protospacer
.***** ******************. *.. 

62. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ggcggcggcgcggccggctgcgccacggcgc	Protospacer
. *******.******** *********   

63. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
tggggcgccacggcctgcggcgccacggcct	Protospacer
   **** ******* ************ * 

64. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccaccgatt	Protospacer
.***** *******.*********** *.. 

65. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
tgcggaaacacggcgggcggcggcacgggcg	Protospacer
  *** ..****** ******* ********

66. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcggcatgggcggcggcgccggacggg	Protospacer
**********.** **********. . * *

67. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcggcatgggcggcggcgccggacggg	Protospacer
**********.** **********. . * *

68. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccaccgatt	Protospacer
.***** *******.*********** *.. 

69. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcggctcgtccggcggcgcggtggcgg	Protospacer
********* ** ********** ..**  *

70. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccaccgatt	Protospacer
.***** *******.*********** *.. 

71. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ctgggcggcaaggcgggcggcgccacggcct	Protospacer
 . ******* *** ************* * 

72. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ctgggcggcaaggcgggcggcgccacggcct	Protospacer
 . ******* *** ************* * 

73. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to MH509441 (Mycobacterium phage Acolyte, complete genome) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
tcaggcggctcggccggcggcaccacggtgc	Protospacer
 * ****** ***********.******   

74. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ggcggcggcacggccggcgatgccaccgtca	Protospacer
. *****************..***** * *.

75. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ggcggcggcacggcgggcgacgccaccgtca	Protospacer
. ************ ****.****** * *.

76. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccgacggtacggccggcggcgccgctgcgg	Protospacer
.***.***.***************.* *  *

77. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcggctcgtccggcggcgcggtggcgg	Protospacer
********* ** ********** ..**  *

78. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcgcggccggcggcgcggacgccg	Protospacer
.********.************* .  * **

79. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcgcggccggcggcgcggacgccg	Protospacer
.********.************* .  * **

80. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcggcgcggccggcggtgccggtgtgg	Protospacer
*********.**********.***.  *  *

81. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcggcgcggccggcggtgccggtgtgg	Protospacer
*********.**********.***.  *  *

82. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
atggcgggctcggccggcggcgccaccggca	Protospacer
*. *  *** **************** ***.

83. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcacggcgggcggcgcgctgttcg	Protospacer
.************* ********  .*  **

84. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgc---cacgggcg	CRISPR spacer
ctcggcggcacggccgacggcgcctactcgg---	Protospacer
 .**************.******   * ***   

85. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca	Protospacer
 ******** **.***********. .***.

86. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca	Protospacer
 ******** **.***********. .***.

87. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca	Protospacer
 ******** **.***********. .***.

88. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca	Protospacer
 ******** **.***********. .***.

89. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca	Protospacer
 ******** **.***********. .***.

90. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP048284 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca	Protospacer
 ******** **.***********. .***.

91. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccctggccacggccggcgccgccgcgggcg	Protospacer
.**   * *********** ****.******

92. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 7, identity: 0.774

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca	Protospacer
 ******** **.***********. .***.

93. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP011053 (Halomonas sp. KO116 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
gtacggggcggtcgcggcggcctgctggccg	Protospacer
*..  ******* .***************. 

94. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.742

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
atggcgggcggtggcggcggcctgccgcagc	Protospacer
..**********..***********.*   *

95. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.742

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
atggcgggcggtggcggcggcctgccgcagc	Protospacer
..**********..***********.*   *

96. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NC_015065 (Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence) position: , mismatch: 8, identity: 0.742

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
ctggattgcggtgacggcagcctgctggctt	Protospacer
 .**   *****.*****.***********.

97. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

98. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

99. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

100. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
acctgcggcacggacggcggcgcatcccggt	Protospacer
*** ********* *********  *  *  

101. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ggcggcggcacggccggcgacgcgaccttgg	Protospacer
. *****************.*** **    *

102. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

103. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

104. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

105. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

106. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

107. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

108. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

109. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

110. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

111. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

112. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
acctgcggcacggacggcggcgcatcccggt	Protospacer
*** ********* *********  *  *  

113. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcaccgccggcggcgccatcgatt	Protospacer
.***** **** *************. *.. 

114. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcactgccggcggcgccatcgatt	Protospacer
.***** **** *************. *.. 

115. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacgaccggcggcgccatcgatt	Protospacer
.***** *****.************. *.. 

116. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ggcggcgggacggccggcggcgccggacgtg	Protospacer
. ****** ***************. . *.*

117. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcaccgccggcggcgccattgatt	Protospacer
.***** **** *************. *.. 

118. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcaccgccggcggcgccatcgatt	Protospacer
.***** **** *************. *.. 

119. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggctggcggcgccatcgatt	Protospacer
.***** *******.**********. *.. 

120. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcacgtccggcggcaccgcttcgg	Protospacer
.*********** ********.**.*    *

121. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcacgtccggcggcaccgcttcgg	Protospacer
.*********** ********.**.*    *

122. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggccggcgtcgccatcgatt	Protospacer
.***** ************ *****. *.. 

123. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

124. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcaccgccggcggcgccatcgatt	Protospacer
.***** **** *************. *.. 

125. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggccggcgtcgccatcgatt	Protospacer
.***** ************ *****. *.. 

126. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggccggcgtcgccatcgatt	Protospacer
.***** ************ *****. *.. 

127. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcacggccggcgtcgccatcgatt	Protospacer
.***** ************ *****. *.. 

128. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

129. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
atttgcggcacggccggcggcgtgacggcga	Protospacer
*.. ******************. ****  .

130. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcacgtccggcggcaccgcttcgg	Protospacer
.*********** ********.**.*    *

131. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcaccgccggcggcgccatcgatt	Protospacer
.***** **** *************. *.. 

132. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ggcggcggcacggccggcgacgcgaccttgg	Protospacer
. *****************.*** **    *

133. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcacgtccggcggcaccgcttcgg	Protospacer
.*********** ********.**.*    *

134. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcacgtccggcggcaccgcttcgg	Protospacer
.*********** ********.**.*    *

135. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gaggacggcacggacggcggcgccccggaca	Protospacer
.  *.******** ********** ***.*.

136. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggctgcaccgccggcggcgccatcgatt	Protospacer
.***** **** *************. *.. 

137. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcggcggggccggcggcgcggcatcca	Protospacer
*********. ************ .*.  *.

138. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

139. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

140. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

141. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gcccgcggcacggtcggcggcgccgccgcga	Protospacer
.** *********.**********.* *  .

142. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP007214 (Burkholderia plantarii strain ATCC 43733 plasmid bpln_1p, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gtgcgcgggacggccggcgccgccacgaacg	Protospacer
..  **** ********** *******..**

143. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

144. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

145. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

146. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

147. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_017078 (Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gttggcggcgtggccggcggcgccacagcag	Protospacer
...******..***************.*  *

148. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

149. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

150. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gcccgcggcacggtcggcggcgccgccgcga	Protospacer
.** *********.**********.* *  .

151. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

152. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

153. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

154. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

155. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

156. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

157. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

158. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

159. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

160. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

161. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

162. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

163. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

164. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

165. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

166. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

167. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

168. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

169. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

170. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

171. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

172. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

173. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

174. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

175. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

176. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

177. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

178. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

179. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_022599 (Micrococcus sp. V7 plasmid pLMV7, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cgccaccgcactgccggcggcgccaccggca	Protospacer
  * .* **** ************** ***.

180. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcgcggccgggggcgccgatgctg	Protospacer
.********.******* ******.  * .*

181. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

182. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

183. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

184. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

185. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

186. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

187. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

188. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

189. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg	Protospacer
.********* *** ********* .   **

190. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
tccggcggcacggccgacggcacccccgtac	Protospacer
 ***************.****.** * *   

191. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

192. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

193. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

194. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

195. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

196. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

197. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

198. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

199. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

200. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

201. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

202. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgcca---cgggcg	CRISPR spacer
cgcgacggcatggccggcggcgccaatccgc---	Protospacer
  **.*****.**************   **    

203. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

204. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

205. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

206. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

207. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

208. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

209. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

210. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

211. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

212. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

213. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

214. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

215. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

216. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

217. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

218. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

219. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

220. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

221. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

222. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

223. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gacaccggcacgcccgccggcgccacggcct	Protospacer
. *. ******* *** *********** * 

224. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.742

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggcacgtccggcggctccggtggac	Protospacer
.*********** ******** **.  **  

225. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.71

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
ttcaaacgcgttaacggcggcctgctggttc	Protospacer
 . . . *** *****************.**

226. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 9, identity: 0.71

gcggcgggcggtaacggcggcctgctggctc	CRISPR spacer
ggcacgggcggcaacggcagcctgctgctca	Protospacer
*  .*******.******.******** .. 

227. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.71

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
cggcgcgccacggccggcggcaccacgcgga	Protospacer
    *** *************.***** * .

228. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to LR606148 (Rhizobium sp. Q54 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.71

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ctcggcgccacggccggcggcgccggagatc	Protospacer
 .***** ****************. .*.. 

229. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to KU310944 (Pseudomonas phage YMC11/06/C171_PPU_BP, complete genome) position: , mismatch: 9, identity: 0.71

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
accggcggcacgcccggcggcgtgttcactg	Protospacer
************ *********.  . . .*

230. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.71

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gttcccttcacggccggcggcggcacggacg	Protospacer
...  *  ************** *****.**

231. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gtcggcggcacggtcggcggcgtcagccagg	Protospacer
..***********.********.**   . *

232. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 9, identity: 0.71

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
ggtggcgggacggccggcgacgccacagagc	Protospacer
. .***** **********.******.*.  

233. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.71

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
tggaggagcacggccggcagcgccacgagcc	Protospacer
   .* .***********.********.** 

234. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.71

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gtcggcggctcgaccggcggcgccatctaca	Protospacer
..******* **.************.  .*.

235. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.71

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gtcggcggctcgaccggcggcgccatctaca	Protospacer
..******* **.************.  .*.

236. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.71

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gtcggcggctcgaccggcggcgccatctaca	Protospacer
..******* **.************.  .*.

237. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.677

accggcggcacggccggcggcgccacgggcg	CRISPR spacer
gccggcggctcggccggcggcaccgaccata	Protospacer
.******** ***********.**.   ...

238. spacer 2.1|1080616|34|NZ_CP053617|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 11, identity: 0.676

aacaacggcggcctgctcagcccgatcaccggca	CRISPR spacer
ggctttttcggcctgctcagcccggtcgccgggc	Protospacer
..*  .  ****************.**.****  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1166620 : 1224917 58 Burkholderia_phage(21.43%) tRNA,portal,plate,integrase,holin,head,capsid,terminase,tail attL 1187163:1187189|attR 1233687:1233713
DBSCAN-SWA_2 2353689 : 2438723 79 Burkholderia_virus(23.81%) coat,tail,integrase attL 2353500:2353554|attR 2369462:2369516
DBSCAN-SWA_3 4847551 : 4902499 57 Burkholderia_phage(35.29%) tRNA,protease,plate,transposase,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage