1. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 2, identity: 0.913
caacggcggcttgctgggcggcc CRISPR spacer
caacggcggcttgctcgccggcc Protospacer
*************** * *****
2. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.913
caacggcggcttgctgggcggcc CRISPR spacer
caacggcggctcgctggacggcc Protospacer
***********.*****.*****
3. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913
caacggcggcttgctgggcggcc CRISPR spacer
caagggcggcctgctgggcggcc Protospacer
*** ******.************
4. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to KF279411 (Mycobacterium phage Adawi, complete genome) position: , mismatch: 2, identity: 0.913
caacggcggcttgctgggcggcc CRISPR spacer
catcggcggcttgctgggcagcc Protospacer
** ****************.***
5. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049160 (Caballeronia sp. SBC1 plasmid pSBC1_4, complete sequence) position: , mismatch: 2, identity: 0.913
caacggcggcttgctgggcggcc CRISPR spacer
caccggaggcttgctgggcggcc Protospacer
** *** ****************
6. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.87
caacggcggcttgctgggcggcc CRISPR spacer
gaacggcggcttgttgggcggct Protospacer
************.********.
7. spacer 2.4|1080765|23|NZ_CP053617|CRISPRCasFinder matches to MT310853 (Microbacterium phage AvGardian, complete genome) position: , mismatch: 3, identity: 0.87
caacggcggcttgctgggcggcc CRISPR spacer
tcacggcggcctgctgggcggcc Protospacer
. ********.************
8. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.871
-gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
ggcggc-ggcggcaacggcggccggctggctt Protospacer
***** *****.********** *******.
9. spacer 1.1|1080331|28|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
ctgacccagcaagtgggcgccaccacca CRISPR spacer
ctggcccagcaagtgcgcgccacctgga Protospacer
***.*********** ******** *
10. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.839
gcggcgggcggtaacggcggcctgctggctc- CRISPR spacer
acggcgggcggcaacggcggcctgc-gccgcg Protospacer
.**********.************* * * *
11. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839
accggcggcacggccggcggcgccacgggcg CRISPR spacer
cgcggcggcgcggccggcggcgccacgcggg Protospacer
*******.***************** * *
12. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
accggcggcacggccggcggcgcc-acgggcg CRISPR spacer
gccggcgccacggccggccgcgccgacaggc- Protospacer
.****** ********** ***** **.***
13. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.839
accggcggcacggccggcggcgccacgggcg- CRISPR spacer
accggcagcacgggcggcggcg-cagggtcgg Protospacer
******.****** ******** ** ** **
14. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 5, identity: 0.839
accggcggcacggccggcggcgccacgggcg- CRISPR spacer
accggcagcacgggcggcggcg-cagggtcgg Protospacer
******.****** ******** ** ** **
15. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 5, identity: 0.839
accggcggcacggccggcggcgc-cacgggcg CRISPR spacer
accggcgccacggcccgcggcgcgcgccggc- Protospacer
******* ******* ******* *.* ***
16. spacer 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 5, identity: 0.821
tggctttggcttggcgctgccgtggttc CRISPR spacer
cagcttcggcttgccgctgccgtggtcc Protospacer
..****.****** ************.*
17. spacer 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 5, identity: 0.821
tggctttggcttggcgctgccgtggttc CRISPR spacer
cagcttcggcttgccgctgccgtggtcc Protospacer
..****.****** ************.*
18. spacer 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.821
tggctttggcttggcgctgccgtggttc CRISPR spacer
cagcttcggcttgccgctgccgtggtcc Protospacer
..****.****** ************.*
19. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NC_011760 (Methylorubrum extorquens CM4 plasmid pCMU02, complete sequence) position: , mismatch: 6, identity: 0.806
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
acgcagggcggcaacggctgcctgctggcgc Protospacer
.** ******.****** ********** *
20. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_015187 (Acidiphilium multivorum AIU301 plasmid pACMV2, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ctgggcggcaaggcgggcggcgccacgggct Protospacer
. ******* *** ***************
21. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ggcggcggcacggccggcgacgcgacggtgg Protospacer
. *****************.*** **** *
22. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
acccgcggcccggccggcggcgccgggtccg Protospacer
*** ***** **************. * **
23. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
acccgcggcccggccggcggcgccgggtccg Protospacer
*** ***** **************. * **
24. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.806
-accggcggcacggccggcggcgccacgggcg CRISPR spacer
cattcgc-gcacggcctgcggcgccaccggcg Protospacer
*.. ** ******** ********** ****
25. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
accggc-ggcacggccggcggcgccacgggcg CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga Protospacer
*** * **** ***************** .
26. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
accggc-ggcacggccggcggcgccacgggcg CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga Protospacer
*** * **** ***************** .
27. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
accggc-ggcacggccggcggcgccacgggcg CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga Protospacer
*** * **** ***************** .
28. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
accggc-ggcacggccggcggcgccacgggcg CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga Protospacer
*** * **** ***************** .
29. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.806
-accggcggcacggccggcggcgccacgggcg CRISPR spacer
cattcgc-gcacggcctgcggcgccaccggcg Protospacer
*.. ** ******** ********** ****
30. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.806
accggc-ggcacggccggcggcgccacgggcg CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga Protospacer
*** * **** ***************** .
31. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accgtcggcccggccggcggcgccgctgtcc Protospacer
**** **** **************.* * *
32. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
accggc-ggcacggccggcggcgccacgggcg CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga Protospacer
*** * **** ***************** .
33. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.806
accggc-ggcacggccggcggcgccacgggcg CRISPR spacer
-ccgccgggcaaggccggcggcgccacggtga Protospacer
*** * **** ***************** .
34. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
agcgggatcacggtcggcgccgccacgggcg Protospacer
* *** . *****.***** ***********
35. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_LR536452 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 3) position: , mismatch: 6, identity: 0.806
--accggcggcacggccggcggcgccacgggcg CRISPR spacer
tcatcgac--cacggccggcggcggcatgggcg Protospacer
*.**.* ************** **.*****
36. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg---- CRISPR spacer
accggcggcggggccggcggcgc----ggcgtcgt Protospacer
*********. ************ ****
37. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcgggacggtcggcggcgcgctggccg Protospacer
******** ****.********* .** **
38. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcgggacggtcggcggcgcgctggccg Protospacer
******** ****.********* .** **
39. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcgggacggtcggcggcgcgctggccg Protospacer
******** ****.********* .** **
40. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcgggacggtcggcggcgcgctggccg Protospacer
******** ****.********* .** **
41. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcgggacggtcggcggcgcgctggccg Protospacer
******** ****.********* .** **
42. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcgggacggtcggcggcgcgctggccg Protospacer
******** ****.********* .** **
43. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcgggacggtcggcggcgcgctggccg Protospacer
******** ****.********* .** **
44. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806
accggcggcacggccggcggcgccacgggcg CRISPR spacer
agcgggatcacggtcggcgccgccacgggcg Protospacer
* *** . *****.***** ***********
45. spacer 5.1|3511659|28|NZ_CP053617|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tggctttggcttggcgctgccgtggttc CRISPR spacer
cccctttggctgggcgctgccgtggtgg Protospacer
. ******** **************
46. spacer 1.1|1080331|28|NZ_CP053617|CRISPRCasFinder matches to X15001 (Coliphage 186 l-strand DNA 77.4-79.6% with genes cp76, cp77, cp78, cp79) position: , mismatch: 7, identity: 0.75
ctgacccagcaagtgggcgccaccacca CRISPR spacer
agactccagcaagtggtcgccagcacca Protospacer
. .*********** ***** *****
47. spacer 1.1|1080331|28|NZ_CP053617|CRISPRCasFinder matches to U32222 (Bacteriophage 186, complete sequence) position: , mismatch: 7, identity: 0.75
ctgacccagcaagtgggcgccaccacca CRISPR spacer
agactccagcaagtggtcgccagcacca Protospacer
. .*********** ***** *****
48. spacer 2.1|1080616|34|NZ_CP053617|CRISPRCasFinder matches to NC_004934 (Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence) position: , mismatch: 7, identity: 0.794
aacaacggcg----gcctgctcagcccgatcaccggca CRISPR spacer
----tcggcgcacagcttgcacagcccgatcaccggca Protospacer
***** **.*** *****************
49. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.774
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
ccggcgggcggcaagggcggcctgcagtggc Protospacer
**********.** ********** * *
50. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
ccggcgggcggcaagggcggcctgcagtggc Protospacer
**********.** ********** * *
51. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
ccggcgggcggcaagggcggcctgcagtggc Protospacer
**********.** ********** * *
52. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP053209 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1A, complete sequence) position: , mismatch: 7, identity: 0.774
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
gcggcgggcggtcgcggcggcctggcgcagc Protospacer
************ .********** .* *
53. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050084 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b2, complete sequence) position: , mismatch: 7, identity: 0.774
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
gcggcgggcggtcgcggcggcctggcgcagc Protospacer
************ .********** .* *
54. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
cggggtgccgggaacggcgccctgctggctc Protospacer
** * *** ******* ***********
55. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.774
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
ccggcgggcggtcagggcggcctggagtccc Protospacer
*********** * ********* * *.*
56. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ctgctcggcacggccggcggcgccatgggca Protospacer
. ********************.****.
57. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggccggcggcgccatcgatt Protospacer
.***** ******************. *..
58. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggccggcggcgccagcgatt Protospacer
.***** ****************** *..
59. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ggcggcggcacggccggcgacgcgacggttc Protospacer
. *****************.*** **** .
60. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggccggcggcgccatcgatt Protospacer
.***** ******************. *..
61. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggccggcggcgccatcgatt Protospacer
.***** ******************. *..
62. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ggcggcggcgcggccggctgcgccacggcgc Protospacer
. *******.******** *********
63. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
tggggcgccacggcctgcggcgccacggcct Protospacer
**** ******* ************ *
64. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccaccgatt Protospacer
.***** *******.*********** *..
65. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
tgcggaaacacggcgggcggcggcacgggcg Protospacer
*** ..****** ******* ********
66. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcggcatgggcggcggcgccggacggg Protospacer
**********.** **********. . * *
67. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcggcatgggcggcggcgccggacggg Protospacer
**********.** **********. . * *
68. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccaccgatt Protospacer
.***** *******.*********** *..
69. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcggctcgtccggcggcgcggtggcgg Protospacer
********* ** ********** ..** *
70. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccaccgatt Protospacer
.***** *******.*********** *..
71. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ctgggcggcaaggcgggcggcgccacggcct Protospacer
. ******* *** ************* *
72. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ctgggcggcaaggcgggcggcgccacggcct Protospacer
. ******* *** ************* *
73. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to MH509441 (Mycobacterium phage Acolyte, complete genome) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
tcaggcggctcggccggcggcaccacggtgc Protospacer
* ****** ***********.******
74. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ggcggcggcacggccggcgatgccaccgtca Protospacer
. *****************..***** * *.
75. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ggcggcggcacggcgggcgacgccaccgtca Protospacer
. ************ ****.****** * *.
76. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccgacggtacggccggcggcgccgctgcgg Protospacer
.***.***.***************.* * *
77. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcggctcgtccggcggcgcggtggcgg Protospacer
********* ** ********** ..** *
78. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcgcggccggcggcgcggacgccg Protospacer
.********.************* . * **
79. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcgcggccggcggcgcggacgccg Protospacer
.********.************* . * **
80. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcggcgcggccggcggtgccggtgtgg Protospacer
*********.**********.***. * *
81. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcggcgcggccggcggtgccggtgtgg Protospacer
*********.**********.***. * *
82. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
atggcgggctcggccggcggcgccaccggca Protospacer
*. * *** **************** ***.
83. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcacggcgggcggcgcgctgttcg Protospacer
.************* ******** .* **
84. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgc---cacgggcg CRISPR spacer
ctcggcggcacggccgacggcgcctactcgg--- Protospacer
.**************.****** * ***
85. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca Protospacer
******** **.***********. .***.
86. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca Protospacer
******** **.***********. .***.
87. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca Protospacer
******** **.***********. .***.
88. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca Protospacer
******** **.***********. .***.
89. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca Protospacer
******** **.***********. .***.
90. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP048284 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca Protospacer
******** **.***********. .***.
91. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccctggccacggccggcgccgccgcgggcg Protospacer
.** * *********** ****.******
92. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 7, identity: 0.774
accggcggcacggccggcggcgccacgggcg CRISPR spacer
cccggcggctcgaccggcggcgccgaaggca Protospacer
******** **.***********. .***.
93. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP011053 (Halomonas sp. KO116 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
gtacggggcggtcgcggcggcctgctggccg Protospacer
*.. ******* .***************.
94. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.742
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
atggcgggcggtggcggcggcctgccgcagc Protospacer
..**********..***********.* *
95. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.742
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
atggcgggcggtggcggcggcctgccgcagc Protospacer
..**********..***********.* *
96. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NC_015065 (Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence) position: , mismatch: 8, identity: 0.742
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
ctggattgcggtgacggcagcctgctggctt Protospacer
.** *****.*****.***********.
97. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
98. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
99. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
100. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
acctgcggcacggacggcggcgcatcccggt Protospacer
*** ********* ********* * *
101. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ggcggcggcacggccggcgacgcgaccttgg Protospacer
. *****************.*** ** *
102. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
103. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
104. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
105. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
106. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
107. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
108. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
109. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
110. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
111. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
112. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
acctgcggcacggacggcggcgcatcccggt Protospacer
*** ********* ********* * *
113. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcaccgccggcggcgccatcgatt Protospacer
.***** **** *************. *..
114. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcactgccggcggcgccatcgatt Protospacer
.***** **** *************. *..
115. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacgaccggcggcgccatcgatt Protospacer
.***** *****.************. *..
116. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ggcggcgggacggccggcggcgccggacgtg Protospacer
. ****** ***************. . *.*
117. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcaccgccggcggcgccattgatt Protospacer
.***** **** *************. *..
118. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcaccgccggcggcgccatcgatt Protospacer
.***** **** *************. *..
119. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggctggcggcgccatcgatt Protospacer
.***** *******.**********. *..
120. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcacgtccggcggcaccgcttcgg Protospacer
.*********** ********.**.* *
121. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcacgtccggcggcaccgcttcgg Protospacer
.*********** ********.**.* *
122. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggccggcgtcgccatcgatt Protospacer
.***** ************ *****. *..
123. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
124. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcaccgccggcggcgccatcgatt Protospacer
.***** **** *************. *..
125. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggccggcgtcgccatcgatt Protospacer
.***** ************ *****. *..
126. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggccggcgtcgccatcgatt Protospacer
.***** ************ *****. *..
127. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcacggccggcgtcgccatcgatt Protospacer
.***** ************ *****. *..
128. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
129. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
atttgcggcacggccggcggcgtgacggcga Protospacer
*.. ******************. **** .
130. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcacgtccggcggcaccgcttcgg Protospacer
.*********** ********.**.* *
131. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcaccgccggcggcgccatcgatt Protospacer
.***** **** *************. *..
132. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ggcggcggcacggccggcgacgcgaccttgg Protospacer
. *****************.*** ** *
133. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcacgtccggcggcaccgcttcgg Protospacer
.*********** ********.**.* *
134. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcacgtccggcggcaccgcttcgg Protospacer
.*********** ********.**.* *
135. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gaggacggcacggacggcggcgccccggaca Protospacer
. *.******** ********** ***.*.
136. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggctgcaccgccggcggcgccatcgatt Protospacer
.***** **** *************. *..
137. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcggcggggccggcggcgcggcatcca Protospacer
*********. ************ .*. *.
138. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
139. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
140. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
141. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gcccgcggcacggtcggcggcgccgccgcga Protospacer
.** *********.**********.* * .
142. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP007214 (Burkholderia plantarii strain ATCC 43733 plasmid bpln_1p, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gtgcgcgggacggccggcgccgccacgaacg Protospacer
.. **** ********** *******..**
143. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
144. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
145. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
146. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
147. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_017078 (Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gttggcggcgtggccggcggcgccacagcag Protospacer
...******..***************.* *
148. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
149. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
150. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gcccgcggcacggtcggcggcgccgccgcga Protospacer
.** *********.**********.* * .
151. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
152. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
153. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
154. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
155. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
156. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
157. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
158. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
159. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
160. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
161. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
162. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
163. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
164. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
165. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
166. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
167. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
168. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
169. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
170. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
171. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
172. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
173. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
174. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
175. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
176. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
177. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
178. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
179. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_022599 (Micrococcus sp. V7 plasmid pLMV7, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
cgccaccgcactgccggcggcgccaccggca Protospacer
* .* **** ************** ***.
180. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcgcggccgggggcgccgatgctg Protospacer
.********.******* ******. * .*
181. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
182. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
183. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
184. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
185. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
186. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
187. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
188. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
189. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcaaggcgggcggcgccttcttcg Protospacer
.********* *** ********* . **
190. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
tccggcggcacggccgacggcacccccgtac Protospacer
***************.****.** * *
191. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
192. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
193. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
194. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
195. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
196. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
197. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
198. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
199. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
200. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
201. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
202. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgcca---cgggcg CRISPR spacer
cgcgacggcatggccggcggcgccaatccgc--- Protospacer
**.*****.************** **
203. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
204. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
205. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
206. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
207. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
208. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
209. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
210. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
211. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
212. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
213. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
214. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
215. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
216. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
217. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
218. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
219. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
220. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
221. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
222. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
223. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gacaccggcacgcccgccggcgccacggcct Protospacer
. *. ******* *** *********** *
224. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.742
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggcacgtccggcggctccggtggac Protospacer
.*********** ******** **. **
225. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.71
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
ttcaaacgcgttaacggcggcctgctggttc Protospacer
. . . *** *****************.**
226. spacer 2.2|1080673|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 9, identity: 0.71
gcggcgggcggtaacggcggcctgctggctc CRISPR spacer
ggcacgggcggcaacggcagcctgctgctca Protospacer
* .*******.******.******** ..
227. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.71
accggcggcacggccggcggcgccacgggcg CRISPR spacer
cggcgcgccacggccggcggcaccacgcgga Protospacer
*** *************.***** * .
228. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to LR606148 (Rhizobium sp. Q54 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.71
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ctcggcgccacggccggcggcgccggagatc Protospacer
.***** ****************. .*..
229. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to KU310944 (Pseudomonas phage YMC11/06/C171_PPU_BP, complete genome) position: , mismatch: 9, identity: 0.71
accggcggcacggccggcggcgccacgggcg CRISPR spacer
accggcggcacgcccggcggcgtgttcactg Protospacer
************ *********. . . .*
230. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.71
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gttcccttcacggccggcggcggcacggacg Protospacer
... * ************** *****.**
231. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gtcggcggcacggtcggcggcgtcagccagg Protospacer
..***********.********.** . *
232. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 9, identity: 0.71
accggcggcacggccggcggcgccacgggcg CRISPR spacer
ggtggcgggacggccggcgacgccacagagc Protospacer
. .***** **********.******.*.
233. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.71
accggcggcacggccggcggcgccacgggcg CRISPR spacer
tggaggagcacggccggcagcgccacgagcc Protospacer
.* .***********.********.**
234. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.71
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gtcggcggctcgaccggcggcgccatctaca Protospacer
..******* **.************. .*.
235. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.71
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gtcggcggctcgaccggcggcgccatctaca Protospacer
..******* **.************. .*.
236. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.71
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gtcggcggctcgaccggcggcgccatctaca Protospacer
..******* **.************. .*.
237. spacer 2.5|1080811|31|NZ_CP053617|CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.677
accggcggcacggccggcggcgccacgggcg CRISPR spacer
gccggcggctcggccggcggcaccgaccata Protospacer
.******** ***********.**. ...
238. spacer 2.1|1080616|34|NZ_CP053617|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 11, identity: 0.676
aacaacggcggcctgctcagcccgatcaccggca CRISPR spacer
ggctttttcggcctgctcagcccggtcgccgggc Protospacer
..* . ****************.**.****