1. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MG945156 (UNVERIFIED: Microviridae sp. isolate 351-1711, complete genome) position: , mismatch: 4, identity: 0.875
tattatggataatctttttctcgatacttttt CRISPR spacer
tttcatggataatctttatcttgatacttttt Protospacer
* *.************* ***.**********
2. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MG945816 (UNVERIFIED: Microviridae sp. isolate 5638-1801, complete genome) position: , mismatch: 4, identity: 0.875
tattatggataatctttttctcgatacttttt CRISPR spacer
tacgatggataatctttttcttgatacgtttt Protospacer
**. *****************.***** ****
3. spacer 1.45|112576|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021746 (Agarilytica rhodophyticola strain 017 plasmid pSU2, complete sequence) position: , mismatch: 5, identity: 0.844
gatggggtgattatcgcagggcatggccgcct CRISPR spacer
gacggaacgattatcgcaggccatggccgcct Protospacer
**.**...************ ***********
4. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MH992157 (Apis mellifera associated microvirus 3 isolate BeeCNH_SP_2675, complete genome) position: , mismatch: 5, identity: 0.844
tattatggataatctttttctcgatacttttt CRISPR spacer
gctcatggataatcttttcctcgatacctttt Protospacer
*.**************.********.****
5. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MG945736 (UNVERIFIED: Microviridae sp. isolate 2388-180102, complete genome) position: , mismatch: 5, identity: 0.844
tattatggataatctttttctcgatacttttt CRISPR spacer
cctgatggataatctttatcttgatacttttt Protospacer
. * ************* ***.**********
6. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MH992174 (Apis mellifera associated microvirus 3 isolate IFH_SP_61, complete genome) position: , mismatch: 5, identity: 0.844
tattatggataatctttttctcgatacttttt CRISPR spacer
gctcatggataatcttttcctcgatacctttt Protospacer
*.**************.********.****
7. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MG945329 (UNVERIFIED: Microviridae sp. isolate 1973-1801, complete genome) position: , mismatch: 5, identity: 0.844
tattatggataatctttttctcgatacttttt CRISPR spacer
tttcatggataatctttatcttgatactttct Protospacer
* *.************* ***.********.*
8. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MH617086 (Microviridae sp. isolate ctcc904, complete genome) position: , mismatch: 6, identity: 0.812
tattatggataatctttttctcgatacttttt CRISPR spacer
gattatggataatatttttctcgacacacatt Protospacer
************ **********.** . **
9. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MH617307 (Microviridae sp. isolate ctbd738, complete genome) position: , mismatch: 6, identity: 0.812
tattatggataatctttttctcgatacttttt CRISPR spacer
tcctcttgataatctttatctagatacttttt Protospacer
* .* * ********** *** **********
10. spacer 1.9|110414|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MT080596 (UNVERIFIED: Staphylococcus phage vB_SauM_EW42, complete genome) position: , mismatch: 7, identity: 0.781
aaacggaaaccctcgttacgtggtggcttatc CRISPR spacer
aaacgggaacccacgttacgtggtggacttct Protospacer
******.***** ************* .* ..
11. spacer 1.9|110414|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MF001365 (Staphylococcus phage SA3, partial genome) position: , mismatch: 7, identity: 0.781
aaacggaaaccctcgttacgtggtggcttatc CRISPR spacer
aaacggcaacccacgttacgtggtggacttct Protospacer
****** ***** ************* .* ..
12. spacer 1.9|110414|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MT080593 (UNVERIFIED: Staphylococcus phage vB_SauM_EW36, complete genome) position: , mismatch: 7, identity: 0.781
aaacggaaaccctcgttacgtggtggcttatc CRISPR spacer
aaacgggaacccacgttacgtggtggacttct Protospacer
******.***** ************* .* ..
13. spacer 1.17|110895|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP008900 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-d4a, complete sequence) position: , mismatch: 7, identity: 0.781
acattatttgcttgtccgccgccaccgccaag CRISPR spacer
ggaatatttggttgtccaccgccaccgccacc Protospacer
. * ****** ******.************
14. spacer 1.17|110895|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043384 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid p1_045001, complete sequence) position: , mismatch: 7, identity: 0.781
acattatttgcttgtccgccgccaccgccaag CRISPR spacer
ggaatatttggttgtccaccgccaccgccacc Protospacer
. * ****** ******.************
15. spacer 1.21|111134|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX353852 (Pseudomonas fragi strain A22 plasmid pPFL, complete sequence) position: , mismatch: 7, identity: 0.781
agcattacatctttttcgatgtagtcgatgat CRISPR spacer
atcattacatctttttccatgaagtccaggcg Protospacer
* *************** *** **** * *
16. spacer 1.59|113416|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NC_004831 (Enterobacteria phage SP6, complete genome) position: , mismatch: 7, identity: 0.781
atgaacagcgcttgatggttgat----ctatcgcct CRISPR spacer
atgaagagcgctggatggttgatacaggtatc---- Protospacer
***** ****** ********** ****
17. spacer 1.59|113416|32|NZ_CP054020|CRISPRCasFinder,CRT matches to MP478607 (Sequence 42 from Patent WO2020012335) position: , mismatch: 7, identity: 0.781
atgaacagcgcttgatggttgat----ctatcgcct CRISPR spacer
atgaagagcgctggatggttgatacaggtatc---- Protospacer
***** ****** ********** ****
18. spacer 1.61|113536|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NC_007762 (Rhizobium etli CFN 42 plasmid p42a, complete sequence) position: , mismatch: 7, identity: 0.781
acgccgat---gttggatgcgctaatcgcaagccc CRISPR spacer
---ctgatttcattggccgcgctaatcgcaagccc Protospacer
*.*** .**** .*****************
19. spacer 1.72|114196|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024444 (Moraxella osloensis strain NP7 plasmid pNP7-1, complete sequence) position: , mismatch: 7, identity: 0.781
tcaaatcatcatgtacaaaccgtttttgagca CRISPR spacer
cctaatcatcatgtagaaaccgcttttgtgtc Protospacer
.* ************ ******.***** *.
20. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to KT264773 (Gokushovirus WZ-2015a isolate 25Fra16, complete genome) position: , mismatch: 7, identity: 0.781
tattatggataatctttttctcgatacttttt CRISPR spacer
ccctatggataatctttatcttgatacttact Protospacer
. .************** ***.******* .*
21. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MH617735 (Microviridae sp. isolate ctbb130, complete genome) position: , mismatch: 7, identity: 0.781
tattatggataatctttttctcgatacttttt CRISPR spacer
gattatggataatctttatatcgatttcttct Protospacer
**************** * ***** ..**.*
22. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to KT264810 (Gokushovirus WZ-2015a isolate 62Brd02, complete genome) position: , mismatch: 7, identity: 0.781
tattatggataatctttttctcgatacttttt CRISPR spacer
tattatggataatctgtttcttgactacttct Protospacer
*************** *****.**. .**.*
23. spacer 1.93|115457|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to KX712143 (Sulfolobus islandicus rudivirus 3 isolate SIRV3, complete genome) position: , mismatch: 7, identity: 0.781
tattatggataatctttttctcgatacttttt CRISPR spacer
atttttctattatctttttttcgatacttttt Protospacer
** * ** ********.************
24. spacer 1.2|109994|32|NZ_CP054020|CRISPRCasFinder,CRT matches to MK613345 (Roseobacter phage CRP-3, complete genome) position: , mismatch: 8, identity: 0.75
attcaaagcggcacctatatcca----ggcgcaatg CRISPR spacer
attcaaggcggcacctatctccacttttacgc---- Protospacer
******.*********** **** .***
25. spacer 1.9|110414|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to CP041517 (Bacillus aryabhattai strain KNU10 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aaacggaaaccctcgttacgtggtggcttatc CRISPR spacer
agatggataccgtcgttacgtggtggccaaaa Protospacer
*.*.*** *** ***************. *
26. spacer 1.19|111014|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028919 (Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gaactgaagcgcaaggagtcgcgcgcgcattt- CRISPR spacer
gccctgaagcgcaaggtggcgcgcgc-tatcca Protospacer
* ************* * ******* .**..
27. spacer 1.34|111915|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to KR063280 (Gordonia phage GMA6, complete genome) position: , mismatch: 8, identity: 0.75
cgaaagcgaagccaacagggatctctgatcga CRISPR spacer
ccaaagcgcagccaacaaggatctcatgccgc Protospacer
* ****** ********.******* ..**
28. spacer 1.39|112216|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 8, identity: 0.75
aacaggtgtacggcggggtggtcggtaccgtt CRISPR spacer
ggccgctgtagggcggggtggtcggcaccctg Protospacer
..* * **** **************.*** *
29. spacer 1.40|112276|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_031050 (Enterobacteria phage vB_EcoS_NBD2, complete genome) position: , mismatch: 8, identity: 0.75
aagtccataccattaagcaggccaagcagctt CRISPR spacer
atgatgttgccattaagcaggccaacgagctt Protospacer
* * . *.**************** *****
30. spacer 1.41|112336|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045374 (Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence) position: , mismatch: 8, identity: 0.75
aaataccaccaggctggcaaaccggcgttcga CRISPR spacer
gcaatggaccaggcggggaaaccggcgttcga Protospacer
. * ******* ** **************
31. spacer 1.47|112696|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016369 (Phaeobacter porticola strain P97 plasmid pP97_e, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcgcattttcgacagccaatcattaccaac CRISPR spacer
ccaagcccattcgacaggcaatcagtaccaac Protospacer
.*. ** . ******** ****** *******
32. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014804 (Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-1, complete sequence) position: , mismatch: 8, identity: 0.75
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
agatatattttctaatgttgataaattaaaga Protospacer
*******.******** ********.. *
33. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MN693139 (Marine virus AFVG_25M90, complete genome) position: , mismatch: 8, identity: 0.75
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
tagtacatcttcaaatgatgataaatctgtaa Protospacer
...**.****** ************** * *
34. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MN693139 (Marine virus AFVG_25M90, complete genome) position: , mismatch: 8, identity: 0.75
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
tagtacatcttcaaatgatgataaatctgtaa Protospacer
...**.****** ************** * *
35. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018256 (Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
cgatatatcttctaatgatgataaatcgctca--- CRISPR spacer
aaatatattttctaatgttgataaa---gtcaaat Protospacer
.******.******** ******* ***
36. spacer 1.53|113056|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 8, identity: 0.75
attcgtcgatgacggtggatagccagacggat CRISPR spacer
attcgtcgacgacggtggaaagcagatcggtg Protospacer
*********.********* *** .. ***
37. spacer 1.53|113056|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 8, identity: 0.75
attcgtcgatgacggtggatagccagacggat CRISPR spacer
attcgtcgacgacggtggacagcaggtcgctg Protospacer
*********.*********.*** .* **
38. spacer 1.53|113056|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 8, identity: 0.75
attcgtcgatgacggtggatagccagacggat CRISPR spacer
attcgtcgacgacggtggaaagcaggtcgctg Protospacer
*********.********* *** .* **
39. spacer 1.53|113056|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 8, identity: 0.75
attcgtcgatgacggtggatagccagacggat CRISPR spacer
attcgtcgacgacggtggacagcaggtcgctg Protospacer
*********.*********.*** .* **
40. spacer 1.53|113056|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 8, identity: 0.75
attcgtcgatgacggtggatagccagacggat CRISPR spacer
attcgtcgacgacggtggacagcaggtcgctg Protospacer
*********.*********.*** .* **
41. spacer 1.53|113056|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 8, identity: 0.75
attcgtcgatgacggtggatagccagacggat CRISPR spacer
attcgtcgacgacggtggaaagcaggtcgctg Protospacer
*********.********* *** .* **
42. spacer 1.54|113116|32|NZ_CP054020|CRISPRCasFinder,CRT matches to MT375042 (Acinetobacter phage vB_AbaP_Alexa, complete genome) position: , mismatch: 8, identity: 0.75
ctcaatatagacctttgaccccttgttaagat CRISPR spacer
gtcaatgtagacctttgaacccttacgcaaat Protospacer
*****.*********** *****.. *.**
43. spacer 1.79|114616|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75
agatttaagcgcgagagttgaagttgctttaa CRISPR spacer
agatttgcgcgcgagagttgaaggaattccaa Protospacer
******. *************** ..*..**
44. spacer 1.80|114676|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 8, identity: 0.75
tttgaaagccgtgccgtacttcgctcaataac CRISPR spacer
taccaaaggcgtgccgtacttcgctgaagaga Protospacer
* . **** **************** ** *.
45. spacer 1.89|115216|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 8, identity: 0.75
gaaaacctgaaagccaatacgaccgaggcgac CRISPR spacer
gatttcctgaaagcctatacgatcgagggcgc Protospacer
** ********** ******.***** .*
46. spacer 1.95|115577|31|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.742
aaaaaaccgactgggtgcagatcggggtttt CRISPR spacer
gccgcaccgactggccgcagatcggggttct Protospacer
. . ********* .*************.*
47. spacer 1.97|115697|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 8, identity: 0.75
tccggctgctgcgccaccggtggcggaataat CRISPR spacer
gccggccgctgcggcaccggtggcggctgcac Protospacer
*****.****** ************ *.
48. spacer 1.97|115697|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP020812 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
tccggctgctgcgccaccggtggcggaataat CRISPR spacer
gccggccgctgcggcaccggtggcggctgcac Protospacer
*****.****** ************ *.
49. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019106 (Synechococcus phage ACG-2014f isolate Syn7803US50, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
50. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019142 (Synechococcus phage ACG-2014f isolate Syn7803C11, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
51. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019149 (Synechococcus phage ACG-2014f isolate Syn7803C21, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
52. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019105 (Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
53. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019123 (Synechococcus phage ACG-2014f isolate Syn7803US7, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
54. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019111 (Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
55. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019148 (Synechococcus phage ACG-2014f isolate Syn7803C19, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
56. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to NC_047712 (Synechococcus phage ACG-2014f isolate Syn7803C7, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcagtat Protospacer
* **********.** *********. *
57. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019093 (Synechococcus phage ACG-2014f isolate Syn7803US30, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
58. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019097 (Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
59. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019099 (Synechococcus phage ACG-2014f isolate Syn7803US3, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
60. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019155 (Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
61. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019141 (Synechococcus phage ACG-2014f isolate Syn7803C10, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
62. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019147 (Synechococcus phage ACG-2014f isolate Syn7803C17, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
63. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019100 (Synechococcus phage ACG-2014f isolate Syn7803US40, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
64. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019101 (Synechococcus phage ACG-2014f isolate Syn7803US42, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
65. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019085 (Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
66. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019091 (Synechococcus phage ACG-2014f isolate Syn7803US26, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
67. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019144 (Synechococcus phage ACG-2014f isolate Syn7803C14, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
68. spacer 1.100|113237|31|NZ_CP054020|PILER-CR matches to KJ019058 (Synechococcus phage ACG-2014f isolate Syn7803C8, complete genome) position: , mismatch: 8, identity: 0.742
gccagagaaccccgacctggttgattttttg CRISPR spacer
ggcagagaaccctgagctggttgatcaatac Protospacer
* **********.** *********. *
69. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to JF974292 (Cyanophage S-SSM2 genomic sequence) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
70. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to KX349303 (Cyanophage S-RIM14 isolate Sn_11_0110, complete genome) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
71. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to KX349304 (Cyanophage S-RIM14 isolate Sn_18_0910, complete genome) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
72. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to KX349306 (Cyanophage S-RIM14 isolate W1_23_0910, complete genome) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
73. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to KX349298 (Cyanophage S-RIM14 isolate LIS_02_1110, complete genome) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
74. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to KX349299 (Cyanophage S-RIM14 isolate LIS_22_0610, complete genome) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
75. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to KX349305 (Cyanophage S-RIM14 isolate Sn_23_0910, complete genome) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
76. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to KX349300 (Cyanophage S-RIM14 isolate Np_11_1211, complete genome) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
77. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to NC_015281 (Synechococcus phage S-ShM2, complete genome) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
78. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to KX349301 (Cyanophage S-RIM14 isolate Np_45_0711, complete genome) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
79. spacer 1.101|113297|31|NZ_CP054020|PILER-CR matches to KX349302 (Cyanophage S-RIM14 isolate RW_03_0110, complete genome) position: , mismatch: 8, identity: 0.742
atgctagatgctctgatcacaagcccgaata CRISPR spacer
ttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
80. spacer 1.5|110174|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP039693 (Agrobacterium larrymoorei strain CFBP5473 plasmid pAlCFBP5473, complete sequence) position: , mismatch: 9, identity: 0.719
tgaaacgtcgtcacctgtcgaaattgtttcct CRISPR spacer
tagtgcagcgtcacctgtcgatcttgtttccg Protospacer
*.. .*. ************* ********
81. spacer 1.7|110294|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048816 (Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed) position: , mismatch: 9, identity: 0.719
gtttaaagttcgtagcgcggccattcgcaatg CRISPR spacer
ggacgtcgttcatcgcgcggccattcgcaagg Protospacer
* .. ****.* **************** *
82. spacer 1.8|110354|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022418 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-3, complete sequence) position: , mismatch: 9, identity: 0.719
agcaatggttatgaacgccttggcgaaattag CRISPR spacer
gatcacggttatgaacgccttggctatatagg Protospacer
... *.****************** * ** .*
83. spacer 1.13|110655|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134433 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 24) position: , mismatch: 9, identity: 0.719
tctcggctctctctgaaagcttttttcatatc CRISPR spacer
ataatgctatcgctgaaagcttttttcatacg Protospacer
. *** ** ******************.
84. spacer 1.13|110655|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134433 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 24) position: , mismatch: 9, identity: 0.719
tctcggctctctctgaaagcttttttcatatc CRISPR spacer
ataatgctatcgctgaaagcttttttcatacg Protospacer
. *** ** ******************.
85. spacer 1.13|110655|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 9, identity: 0.719
tctcggctctctctgaaagcttttttcatatc CRISPR spacer
ataatgctatcgctgaaagcttttttcatacg Protospacer
. *** ** ******************.
86. spacer 1.13|110655|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134420 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 11) position: , mismatch: 9, identity: 0.719
tctcggctctctctgaaagcttttttcatatc CRISPR spacer
ataatgctatcgctgaaagcttttttcatacg Protospacer
. *** ** ******************.
87. spacer 1.13|110655|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134422 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 13) position: , mismatch: 9, identity: 0.719
tctcggctctctctgaaagcttttttcatatc CRISPR spacer
ataatgctatcgctgaaagcttttttcatacg Protospacer
. *** ** ******************.
88. spacer 1.19|111014|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 9, identity: 0.719
---gaactgaagcgcaaggagtcgcgcgcgcattt CRISPR spacer
gtcggctt---ccgcgaggagtcgcgcacgcattt Protospacer
*. .* ***.***********.*******
89. spacer 1.26|111435|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031116 (Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atgtcctcttcgtcgttatccagcagcgcgtg CRISPR spacer
gctccatcgtcgtcgttctccagcagcgcgac Protospacer
.. .* ** ******** ************
90. spacer 1.26|111435|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019446 (Kosakonia cowanii JCM 10956 = DSM 18146 strain 888-76 plasmid p888-76-1, complete sequence) position: , mismatch: 9, identity: 0.719
atgtcctcttcgtcgttatccagcagcgcgtg CRISPR spacer
atcaggtcttccccgttatccagcagcgccgt Protospacer
** ***** .****************
91. spacer 1.31|111735|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tattagcggaagctctttttgcaggtgtgttt CRISPR spacer
catcagcggaagctccttttgcagccccggat Protospacer
.**.***********.******** . .* *
92. spacer 1.33|111855|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 9, identity: 0.719
aactaaataaccgccggcggcgcttggcttat CRISPR spacer
tagtaaataaccgctgggggcgcttggtcgcc Protospacer
* ***********.** *********.. .
93. spacer 1.36|112035|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MH884508 (Bacillus phage vB_BcoS-136, complete genome) position: , mismatch: 9, identity: 0.719
agcctgcaagacaaaggattaatcgaatcaac CRISPR spacer
aagattgaagacataggattaatcgaagcatt Protospacer
*. * ****** ************* ** .
94. spacer 1.39|112216|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
aacaggtgtacggcggggtggtcggtaccgtt CRISPR spacer
gcgatgtgtacggcggtgtcgtcggtacaaat Protospacer
. * *********** ** ******** . *
95. spacer 1.41|112336|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.719
aaataccaccaggctggcaaaccggcgttcga CRISPR spacer
ggcggcaacaagcctggcaaaccggcgttcgg Protospacer
.. .* ** ** ******************.
96. spacer 1.42|112396|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT838199 (Escherichia coli isolate WI1 isolate plasmid pWI1-incI1, complete sequence) position: , mismatch: 9, identity: 0.719
aaaacaatatctacctcgctaaccgaaacggt CRISPR spacer
caaacaatatccacttcgctaaccggcagacc Protospacer
**********.**.**********. * . .
97. spacer 1.42|112396|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028120 (Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence) position: , mismatch: 9, identity: 0.719
aaaacaatatctacctcgctaaccgaaacggt CRISPR spacer
caaacaatatccacttcgctaaccggcagacc Protospacer
**********.**.**********. * . .
98. spacer 1.42|112396|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to LC485173 (Escherichia coli B1 plasmid pColBM-B1 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
aaaacaatatctacctcgctaaccgaaacggt CRISPR spacer
caaacaatatccacttcgctaaccggcagacc Protospacer
**********.**.**********. * . .
99. spacer 1.42|112396|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to KT287080 (Enterobacter phage phiEap-2, complete genome) position: , mismatch: 9, identity: 0.719
aaaacaatatctacctcgctaaccgaaacggt CRISPR spacer
agtacaatatctacttcgctaacagagattac Protospacer
*. ***********.******** **.*. ..
100. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_014937 (Bacillus thuringiensis CT43 plasmid pBMB0558, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
101. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP004875 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB95, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
102. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_017202 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT127, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
103. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010580 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB76, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
104. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011357 (Bacillus thuringiensis strain YC-10 plasmid pYC20, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
105. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015155 (Bacillus thuringiensis strain Bc601 plasmid pBTBC5, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
106. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013058 (Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-3, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
107. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007614 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB95, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
108. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP004868 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB94, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
109. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010110 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-4, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
110. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to CP020756 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-17, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
111. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_020393 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-107, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
112. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010092 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB126, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
113. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021063 (Bacillus thuringiensis strain ATCC 10792 plasmid poh2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
114. spacer 1.50|112876|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_020239 (Bacillus thuringiensis serovar kurstaki str. HD73 plasmid pHT77, complete sequence) position: , mismatch: 9, identity: 0.719
cgatatatcttctaatgatgataaatcgctca CRISPR spacer
caatacatcttctaatgattataaagttattg Protospacer
*.***.************* ***** . *..
115. spacer 1.52|112996|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
tgcagcgaattcgcttcgacattgataaatga CRISPR spacer
cgcagcgaattcccttcgaccttgcggaagcc Protospacer
.*********** ******* *** .**
116. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019106 (Synechococcus phage ACG-2014f isolate Syn7803US50, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
117. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019142 (Synechococcus phage ACG-2014f isolate Syn7803C11, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
118. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019149 (Synechococcus phage ACG-2014f isolate Syn7803C21, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
119. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019105 (Synechococcus phage ACG-2014f isolate Syn7803US4, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
120. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019123 (Synechococcus phage ACG-2014f isolate Syn7803US7, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
121. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019111 (Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
122. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019148 (Synechococcus phage ACG-2014f isolate Syn7803C19, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
123. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NC_047712 (Synechococcus phage ACG-2014f isolate Syn7803C7, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcagtat Protospacer
.* **********.** *********. *
124. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019093 (Synechococcus phage ACG-2014f isolate Syn7803US30, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
125. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019097 (Synechococcus phage ACG-2014f isolate Syn7803US37, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
126. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019099 (Synechococcus phage ACG-2014f isolate Syn7803US3, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
127. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019155 (Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
128. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019141 (Synechococcus phage ACG-2014f isolate Syn7803C10, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
129. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019147 (Synechococcus phage ACG-2014f isolate Syn7803C17, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
130. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019100 (Synechococcus phage ACG-2014f isolate Syn7803US40, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
131. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019101 (Synechococcus phage ACG-2014f isolate Syn7803US42, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
132. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019085 (Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
133. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019091 (Synechococcus phage ACG-2014f isolate Syn7803US26, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
134. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019144 (Synechococcus phage ACG-2014f isolate Syn7803C14, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
135. spacer 1.56|113236|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KJ019058 (Synechococcus phage ACG-2014f isolate Syn7803C8, complete genome) position: , mismatch: 9, identity: 0.719
cgccagagaaccccgacctggttgattttttg CRISPR spacer
tggcagagaaccctgagctggttgatcaatac Protospacer
.* **********.** *********. *
136. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KX349303 (Cyanophage S-RIM14 isolate Sn_11_0110, complete genome) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
137. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KX349304 (Cyanophage S-RIM14 isolate Sn_18_0910, complete genome) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
138. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KX349306 (Cyanophage S-RIM14 isolate W1_23_0910, complete genome) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
139. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KX349298 (Cyanophage S-RIM14 isolate LIS_02_1110, complete genome) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
140. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KX349299 (Cyanophage S-RIM14 isolate LIS_22_0610, complete genome) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
141. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KX349305 (Cyanophage S-RIM14 isolate Sn_23_0910, complete genome) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
142. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to JF974292 (Cyanophage S-SSM2 genomic sequence) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
143. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KX349300 (Cyanophage S-RIM14 isolate Np_11_1211, complete genome) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
144. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NC_015281 (Synechococcus phage S-ShM2, complete genome) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
145. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KX349301 (Cyanophage S-RIM14 isolate Np_45_0711, complete genome) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
146. spacer 1.57|113296|32|NZ_CP054020|CRISPRCasFinder,CRT matches to KX349302 (Cyanophage S-RIM14 isolate RW_03_0110, complete genome) position: , mismatch: 9, identity: 0.719
aatgctagatgctctgatcacaagcccgaata CRISPR spacer
cttgctagatggtctgaccacaagcagcactg Protospacer
********* *****.******* * *.
147. spacer 1.59|113416|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP040762 (Paracoccus sp. 2251 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atgaacagcgcttgatggttgatctatcgcct CRISPR spacer
aagaacagcgcctgctggttgatctggaccaa Protospacer
* *********.** **********. *
148. spacer 1.59|113416|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atgaacagcgcttgatggttgatctatcgcct CRISPR spacer
aagaacagcgcctgctggttgatctggaccag Protospacer
* *********.** **********. *
149. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP050184 (Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence) position: , mismatch: 9, identity: 0.719
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacgtc Protospacer
. *. *********** * *********.*..
150. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP050184 (Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence) position: , mismatch: 9, identity: 0.719
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacgtc Protospacer
. *. *********** * *********.*..
151. spacer 1.67|113896|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to KX765864 (Salmonella phage ST-374, complete genome) position: , mismatch: 9, identity: 0.719
atttagagcaatggttacgaccaccccaaaca CRISPR spacer
tccgaaagcaacggttacgaccacgccaaccg Protospacer
.. *.*****.************ **** *.
152. spacer 1.67|113896|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to KX765863 (Salmonella phage ST-118, complete genome) position: , mismatch: 9, identity: 0.719
atttagagcaatggttacgaccaccccaaaca CRISPR spacer
tccgaaagcaacggttacgaccacgccaaccg Protospacer
.. *.*****.************ **** *.
153. spacer 1.67|113896|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_048655 (Salmonella phage BSPM4, complete genome) position: , mismatch: 9, identity: 0.719
atttagagcaatggttacgaccaccccaaaca CRISPR spacer
tccgaaagcaacggttacgaccacgccaaccg Protospacer
.. *.*****.************ **** *.
154. spacer 1.67|113896|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to KX765862 (Salmonella phage ST-101, complete genome) position: , mismatch: 9, identity: 0.719
atttagagcaatggttacgaccaccccaaaca CRISPR spacer
tccgaaagcaacggttacgaccacgccaaccg Protospacer
.. *.*****.************ **** *.
155. spacer 1.95|115577|31|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.71
aaaaaaccgactgggtgcagatcggggtttt CRISPR spacer
acggaaccggctgggtgcagatcgggacgac Protospacer
* ..*****.****************.. .
156. spacer 1.97|115697|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719
tccggctgctgcgccaccggtggcggaataat CRISPR spacer
gacggcggctgcgccgccggtggcggcccagg Protospacer
**** ********.********** .*.
157. spacer 1.97|115697|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP036222 (Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tccggctgctgcgccaccggtggcggaataat CRISPR spacer
atcggctgctgcgccaccggaggaggcgcagc Protospacer
.****************** ** ** ..*..
158. spacer 1.97|115697|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP009406 (Mycobacterium avium subsp. hominissuis strain OCU464 plasmid p18K, complete sequence) position: , mismatch: 9, identity: 0.719
tccggctgctgcgccaccggtggcggaataat CRISPR spacer
atcggctgctgcgccaccggaggaggcgcagc Protospacer
.****************** ** ** ..*..
159. spacer 1.97|115697|32|NZ_CP054020|CRISPRCasFinder,CRT matches to MK016490 (Arthrobacter phage Anjali, complete genome) position: , mismatch: 9, identity: 0.719
tccggctgctgcgccaccggtggcgga-ataat CRISPR spacer
cgcggctgcggctccaccggtggcgagcgtca- Protospacer
. ******* ** ************.. .* *
160. spacer 1.103|113417|31|NZ_CP054020|PILER-CR matches to NZ_CP040762 (Paracoccus sp. 2251 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71
tgaacagcgcttgatggttgatctatcgcct CRISPR spacer
agaacagcgcctgctggttgatctggaccaa Protospacer
*********.** **********. *
161. spacer 1.103|113417|31|NZ_CP054020|PILER-CR matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71
tgaacagcgcttgatggttgatctatcgcct CRISPR spacer
agaacagcgcctgctggttgatctggaccag Protospacer
*********.** **********. *
162. spacer 1.105|113537|31|NZ_CP054020|PILER-CR matches to NC_007762 (Rhizobium etli CFN 42 plasmid p42a, complete sequence) position: , mismatch: 9, identity: 0.71
cgccgatgttggatgcgctaatcgcaagccc CRISPR spacer
tgatttcattggccgcgctaatcgcaagccc Protospacer
.* . ..**** .*****************
163. spacer 2.1|1396459|31|NZ_CP054020|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
aacaatattgtgcttaccgattttggttgtc CRISPR spacer
gtaaatattgtgtctaccgattttggcgatt Protospacer
. *********..************. .*.
164. spacer 1.7|110294|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 10, identity: 0.688
gtttaaagttcgtagcgcggccattcgcaatg CRISPR spacer
tcgccgagttcgtggcgcggcccttcgcactc Protospacer
. . .*******.******** ****** *
165. spacer 1.7|110294|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
gtttaaagttcgtagcgcggccattcgcaatg CRISPR spacer
acctcgagctcgtagcgcggccagtcgcacgc Protospacer
...* .**.************** *****
166. spacer 1.19|111014|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041223 (Porphyrobacter sp. YT40 plasmid pYT40, complete sequence) position: , mismatch: 10, identity: 0.688
gaactgaagcgcaaggagtcgcgcgcgcattt CRISPR spacer
atcgtgaagcgcaaggcgtcgcgcccgatcgt Protospacer
. ************ ******* ** . *
167. spacer 1.20|111074|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_030920 (Bacillus phage Eldridge, complete genome) position: , mismatch: 10, identity: 0.688
tgaactcattgcaacttgatataggcgcttgc CRISPR spacer
ataactcattgctacttgataaaggtctaagg Protospacer
********** ******** ***. . *
168. spacer 1.22|111194|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_048015 (Cyanophage S-TIM4, complete genome) position: , mismatch: 10, identity: 0.688
agcgcaaaggtgatcttggtattgcggatctc CRISPR spacer
ctaaggaaggtgatcttggtattgcagatgat Protospacer
. .*******************.*** .
169. spacer 1.22|111194|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MH512890 (Cyanophage S-TIM4) position: , mismatch: 10, identity: 0.688
agcgcaaaggtgatcttggtattgcggatctc CRISPR spacer
ctaaggaaggtgatcttggtattgcagatgat Protospacer
. .*******************.*** .
170. spacer 1.22|111194|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_015283 (Prochlorococcus phage P-RSM4, complete genome) position: , mismatch: 10, identity: 0.688
agcgcaaaggtgatcttggtattgcggatctc CRISPR spacer
ctaaggaaggtgatcttggtattgcagatgat Protospacer
. .*******************.*** .
171. spacer 1.22|111194|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to MN694125 (Marine virus AFVG_250M700, complete genome) position: , mismatch: 10, identity: 0.688
agcgcaaaggtgatcttggtattgcggatctc CRISPR spacer
taaccaaaggtgttcttggttttgcgggtgat Protospacer
. ******** ******* ******.* .
172. spacer 1.53|113056|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048426 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
attcgtcgatgacggtggatagccagacggat CRISPR spacer
attcgtcgatgacggtcgaaagcagttcaccc Protospacer
**************** ** *** . *. .
173. spacer 1.53|113056|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 10, identity: 0.688
attcgtcgatgacggtggatagccagacggat CRISPR spacer
attcgtcgatgacggtcgagagcagttcactg Protospacer
**************** ** *** . *.
174. spacer 1.59|113416|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 10, identity: 0.688
atgaacagcgcttgatggttgatctatcgcct CRISPR spacer
aagaacagcgcctgctggttgatctgcacgag Protospacer
* *********.** **********..
175. spacer 1.59|113416|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 10, identity: 0.688
atgaacagcgcttgatggttgatctatcgcct CRISPR spacer
aagaacagcgcctgctggttgatctgcacgag Protospacer
* *********.** **********..
176. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP014284 (Bacillus thuringiensis strain Bt185 plasmid pBT1850294, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
177. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP010578 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB232, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
178. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP015177 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgaggccaaagaaacttc Protospacer
. *. *********** *.*********. ..
179. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
180. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP032609 (Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
181. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to CP046513 (Bacillus cereus strain JHU plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
182. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
183. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
184. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP045607 (Bacillus cereus strain SB1 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
185. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP009636 (Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
186. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NC_018492 (Bacillus cereus FRI-35 plasmid p01, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaactta Protospacer
. *. *********** * *********. .
187. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP016589 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
188. spacer 1.63|113656|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP053962 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
189. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP014284 (Bacillus thuringiensis strain Bt185 plasmid pBT1850294, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
190. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP010578 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB232, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
191. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP015177 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgaggccaaagaaacttc Protospacer
. *. *********** *.*********. ..
192. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
193. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP032609 (Bacillus thuringiensis strain QZL38 plasmid p.2, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
194. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to CP046513 (Bacillus cereus strain JHU plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
195. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
196. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
197. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP045607 (Bacillus cereus strain SB1 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
198. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP009636 (Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
199. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NC_018492 (Bacillus cereus FRI-35 plasmid p01, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaactta Protospacer
. *. *********** * *********. .
200. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP016589 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
201. spacer 1.64|113716|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP053962 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tttgagaaaatcggtgtgaccaaagaaatgct CRISPR spacer
catatgaaaatcggtgagtccaaagaaacttc Protospacer
. *. *********** * *********. ..
202. spacer 1.97|115697|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tccggctgctgcgccaccggtggcggaataat CRISPR spacer
aacggctgccgcggcaccggtggcgtgtcatc Protospacer
*******.*** *********** . .* .
203. spacer 1.103|113417|31|NZ_CP054020|PILER-CR matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 10, identity: 0.677
tgaacagcgcttgatggttgatctatcgcct CRISPR spacer
agaacagcgcctgctggttgatctgcacgag Protospacer
*********.** **********..
204. spacer 1.103|113417|31|NZ_CP054020|PILER-CR matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 10, identity: 0.677
tgaacagcgcttgatggttgatctatcgcct CRISPR spacer
agaacagcgcctgctggttgatctgcacgag Protospacer
*********.** **********..
205. spacer 2.1|1396459|31|NZ_CP054020|CRISPRCasFinder matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 10, identity: 0.677
aacaatattgtgcttaccgattttggttgtc CRISPR spacer
aataatattatgcttaccgatttaatacaag Protospacer
**.******.************* . ..
206. spacer 2.1|1396459|31|NZ_CP054020|CRISPRCasFinder matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 10, identity: 0.677
aacaatattgtgcttaccgattttggttgtc CRISPR spacer
aataatattatgcttaccgatttaatacaag Protospacer
**.******.************* . ..
207. spacer 1.6|110234|32|NZ_CP054020|CRISPRCasFinder,CRT matches to NC_012855 (Ralstonia pickettii 12D plasmid pRp12D01, complete sequence) position: , mismatch: 11, identity: 0.656
aagcggattgatgggccagttaccgtttgccc CRISPR spacer
ggctggattgatggcccagctaccgttgaaat Protospacer
.. .********** ****.******* . .
208. spacer 1.34|111915|32|NZ_CP054020|CRISPRCasFinder,CRT,PILER-CR matches to NC_014908 (Alicycliphilus denitrificans BC plasmid pALIDE01, complete sequence) position: , mismatch: 11, identity: 0.656
cgaaagcgaagccaacagggatctctgatcga CRISPR spacer
tgaaagagaagccaacaggcatcttcaccatt Protospacer
.***** ************ ****... .
209. spacer 1.97|115697|32|NZ_CP054020|CRISPRCasFinder,CRT matches to CP054924 (Verrucosispora sp. NA02020 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
tccggctgctgcgccaccggtggcggaataat CRISPR spacer
gccggctgcggcgccaccggtcgcacccgggc Protospacer
******** *********** **. ...
210. spacer 1.97|115697|32|NZ_CP054020|CRISPRCasFinder,CRT matches to MT114163 (Mycobacterium phage Settecandela, complete genome) position: , mismatch: 11, identity: 0.656
tccggctgctgcgccaccggtggcggaataat CRISPR spacer
cgcggctgctgcgccacccatggcgagccgtg Protospacer
. **************** .*****.. ..
211. spacer 1.97|115697|32|NZ_CP054020|CRISPRCasFinder,CRT matches to MK937592 (Mycobacterium phage Phrappuccino, complete genome) position: , mismatch: 11, identity: 0.656
tccggctgctgcgccaccggtggcggaataat CRISPR spacer
cgcggctgctgcgccacccatggcgagccgtg Protospacer
. **************** .*****.. ..
