1. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 3, identity: 0.9
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cccggtcgccgtctcggtcggcgtctcgat Protospacer
*.****** *******************.*
2. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.867
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
aacgggcggcggctcggtcggcgtctcggt Protospacer
*** ***** ******************
3. spacer 2.15|4437999|30|NZ_CP054043|CRT matches to NC_009958 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI04, complete sequence) position: , mismatch: 4, identity: 0.867
ctcggtt--ggcgtctcggtcggtgtctcggt CRISPR spacer
--cggttgcggcgcctcggtcggtgtctcgga Protospacer
***** ****.*****************
4. spacer 2.17|4438119|30|NZ_CP054043|CRT matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 4, identity: 0.867
ctccgttggcgtctcggtcggtgtctccgt CRISPR spacer
cacaggtggcggctcggtcggtgtctccgt Protospacer
* * * ***** ******************
5. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgccgtcggcgcctcggtcgccgtctcggg Protospacer
* * *******.******** ********
6. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to MT639643 (Microbacterium phage FreddieHg, complete genome) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
* ** ************* ******** *
7. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to MT818420 (Microbacterium phage Gilda, complete genome) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
* ** ************* ******** *
8. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to MK737941 (Microbacterium phage Rachella, complete genome) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
* ** ************* ******** *
9. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to MK801732 (Microbacterium phage NarutoRun, complete genome) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
* ** ************* ******** *
10. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_047986 (Microbacterium phage Krampus, complete genome) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
* ** ************* ******** *
11. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to MK801731 (Microbacterium phage Anakin, complete genome) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
* ** ************* ******** *
12. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to MN497954 (Microbacterium phage Hiddenleaf, complete genome) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
* ** ************* ******** *
13. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to MH271292 (Microbacterium phage AnnaSerena, complete genome) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
* ** ************* ******** *
14. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to MT684591 (Microbacterium phage Chivey, complete genome) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
* ** ************* ******** *
15. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to MT684592 (Microbacterium phage Aesir, complete genome) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
* ** ************* ******** *
16. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgccgtcggcgcctcggtcgccgtctcggg Protospacer
* * *******.******** ********
17. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 5, identity: 0.833
ctcggtcggcgtctcggtcggc-gtctcggt CRISPR spacer
atcggtcggcggctcggtcggcagcgtcgg- Protospacer
********** ********** *. ****
18. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_009958 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI04, complete sequence) position: , mismatch: 5, identity: 0.833
ctcggt--cggcgtctcggtcggcgtctcggt CRISPR spacer
--cggttgcggcgcctcggtcggtgtctcgga Protospacer
**** *****.*********.*******
19. spacer 2.15|4437999|30|NZ_CP054043|CRT matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 5, identity: 0.833
ctcggttggcgtctcggtcggtgtctcggt CRISPR spacer
cacaggtggcggctcggtcggtgtctccgt Protospacer
* *.* ***** *************** **
20. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
21. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
22. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
23. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
24. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
25. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
26. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
27. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
28. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
29. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
30. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
31. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
32. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
33. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
34. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
35. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
36. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
37. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
38. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
39. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
40. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgacatcggcgtctcggtcggcggctcggg Protospacer
* .****************** *****
41. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to AM419438 (Archaeal BJ1 virus complete genome) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gcgggtcagcgtctcggtcagcgtctcgtt Protospacer
. ****.***********.******** *
42. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_008695 (Archaeal BJ1 virus, complete genome) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gcgggtcagcgtctcggtcagcgtctcgtt Protospacer
. ****.***********.******** *
43. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to HM461982 (Burkholderia phage KS14, complete genome) position: , mismatch: 6, identity: 0.8
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ctcggccggcgtcgcggtcggcgacaagga Protospacer
*****.******* ********* * **
44. spacer 2.9|4437735|30|NZ_CP054043|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 6, identity: 0.8
ttccgttggcgtctcggttggcgtctcggt CRISPR spacer
cacgggtggcggctcggtcggcgtctcggt Protospacer
. * * ***** ******.***********
45. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 6, identity: 0.8
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cacgggtggcggctcggtcggcgtctcggt Protospacer
. * * ***** *************** **
46. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 6, identity: 0.8
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cacaggtggcggctcggtcggtgtctccgt Protospacer
. * * ***** *********.********
47. spacer 2.15|4437999|30|NZ_CP054043|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
ctcggttggcgtctcggtcggtgtctcggt CRISPR spacer
gacggttggcggctcggtcagtgtctcagg Protospacer
********* *******.*******.*
48. spacer 2.17|4438119|30|NZ_CP054043|CRT matches to CP000877 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU02, complete sequence) position: , mismatch: 6, identity: 0.8
ctccgttggcgtctcggtcggtgtctccgt CRISPR spacer
ctccgttggcgtattggtcggtgtggtggt Protospacer
************ *.********* . **
49. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
50. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
51. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ctcggtcggcgtcgcggtcggcgcgggcgg Protospacer
************* *********. *
52. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
53. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
54. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
55. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
56. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
57. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
58. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
59. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
60. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
61. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
62. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
63. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
64. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ctcggtcggcgtcgcggtcggcgcgggcgg Protospacer
************* *********. *
65. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
66. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
67. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
68. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
69. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
70. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
71. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
72. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_GU811235 (Sphingobium chungbukense strain DJ77 plasmid pSY3, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ctcgggcggcgtctcggtcggcgatgagcc Protospacer
***** ***************** . * .
73. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cccggtcggcctctcgctcggcgtcgtcga Protospacer
*.******** ***** ******** . *
74. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ggcctccggcgtctcgctcggcgtttcggt Protospacer
* .********** *******.*****
75. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gccggtcggcgtctcgatcggcgcctgctt Protospacer
.**************.******.** *
76. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP027115 (Gordonia alkanivorans strain YC-RL2 plasmid pYYC01, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgtggtcggcgtcgcggtcggcggctacgg Protospacer
* .********** ********* ** *
77. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP028569 (Acinetobacter pittii strain WCHAP005046 plasmid p1_005046, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
78. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to CP033546 (Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-1, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
79. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP033769 (Acinetobacter baumannii strain FDAARGOS_533 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
80. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to CP042210 (Acinetobacter baumannii strain DS002 plasmid pTS134338, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
81. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
82. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gaccgtcggcgtatcggtcggcgtcgggga Protospacer
* ******** ************ **
83. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
84. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgaggtcggcgtctcggccagcgtcttgcg Protospacer
* **************.*.******.*
85. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ctcggtcggcctctccgtcggcgacgatct Protospacer
********** **** ******* * *
86. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to CP033559 (Acinetobacter nosocomialis strain 2012C01-137 plasmid p2012C01-137-2, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
87. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to CP019144 (Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
88. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP044357 (Acinetobacter baumannii strain CAM180-1 plasmid pCAM180A, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
89. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
90. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
91. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
92. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
93. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
94. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
ctcggtcgacatctcggtcggcgatgacgt Protospacer
********.*.************ . **
95. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP038259 (Acinetobacter baumannii strain 39741 plasmid pEH_gr13, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
96. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
97. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP028139 (Acinetobacter baumannii strain NCIMB 8209 plasmid pAbNCIMB8209_134, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
98. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_AP018825 (Acinetobacter ursingii strain M3 plasmid pAURM-1, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
99. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
tccggtcggcgtcttcgtcggcgtcatggc Protospacer
..************. ********* .**.
100. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP038263 (Acinetobacter baumannii strain LEV1449/17Ec plasmid pEC_gr13, complete sequence) position: , mismatch: 7, identity: 0.767
---ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gagttc---cggcgtgttggtcggcgtctcggc Protospacer
.** ****** *.**************.
101. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to AY364845 (Virus PhiCh1 pBgB51 capsid protein, int1, and capsid protein genes, complete cds) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgatcggcgtctcggtcggcctcctcat Protospacer
* **.***************** **.. .*
102. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to AY364846 (Virus PhiCh1 pBgB52 capsid protein, int1, and capsid protein genes, complete cds) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgatcggcgtctcggtcggcctcctcat Protospacer
* **.***************** **.. .*
103. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to AF440695 (Virus PhiCh1, complete genome) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgatcggcgtctcggtcggcctcctcat Protospacer
* **.***************** **.. .*
104. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_004084 (Natrialba phage PhiCh1, complete genome) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgatcggcgtctcggtcggcctcctcat Protospacer
* **.***************** **.. .*
105. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to AY364844 (Virus PhiCh1 pBgB43 ORF34-43, integrase, and ORF36-43 genes, complete cds) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgatcggcgtctcggtcggcctcctcat Protospacer
* **.***************** **.. .*
106. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to AY364843 (Virus PhiCh1 pBgB5 ORF34-5, integrase, and ORF36-5 genes, complete cds) position: , mismatch: 7, identity: 0.767
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cgcgatcggcgtctcggtcggcctcctcat Protospacer
* **.***************** **.. .*
107. spacer 2.9|4437735|30|NZ_CP054043|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggttggcgtctcggt CRISPR spacer
acacgacggcgtcgctgttggcgtctcggt Protospacer
. ** .****** * **************
108. spacer 2.9|4437735|30|NZ_CP054043|CRT matches to CP000618 (Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggttggcgtctcggt CRISPR spacer
gacggggggcggctcggttggcgtgtcggt Protospacer
* * **** ************ *****
109. spacer 2.9|4437735|30|NZ_CP054043|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggttggcgtctcggt CRISPR spacer
aacgggcggcggctcggtcggcgtctcggt Protospacer
* * .**** ******.***********
110. spacer 2.9|4437735|30|NZ_CP054043|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggttggcgtctcggt CRISPR spacer
acacgacggcgtcgctgttggcgtctcggt Protospacer
. ** .****** * **************
111. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to MT639643 (Microbacterium phage FreddieHg, complete genome) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
. * *.*********** **********
112. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to MT818420 (Microbacterium phage Gilda, complete genome) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
. * *.*********** **********
113. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to MK737941 (Microbacterium phage Rachella, complete genome) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
. * *.*********** **********
114. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to MK801732 (Microbacterium phage NarutoRun, complete genome) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
. * *.*********** **********
115. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to NC_047986 (Microbacterium phage Krampus, complete genome) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
. * *.*********** **********
116. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to MK801731 (Microbacterium phage Anakin, complete genome) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
. * *.*********** **********
117. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to MN497954 (Microbacterium phage Hiddenleaf, complete genome) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
. * *.*********** **********
118. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to MH271292 (Microbacterium phage AnnaSerena, complete genome) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
. * *.*********** **********
119. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to MT684591 (Microbacterium phage Chivey, complete genome) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
. * *.*********** **********
120. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to MT684592 (Microbacterium phage Aesir, complete genome) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcgttcggcgtctcggtgggcgtctccgg Protospacer
. * *.*********** **********
121. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cccggtcgccgtctcggtcggcgtctcgat Protospacer
..* **.* ****************** .*
122. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
aacgggcggcggctcggtcggcgtctcggt Protospacer
* * .**** *************** **
123. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to NC_001387 (Streptomyces lividans plasmid pIJ101, complete sequence) position: , mismatch: 7, identity: 0.767
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgccgctggcggctcggtcggcgtcgtcat Protospacer
. ***.***** ************* .*.*
124. spacer 2.17|4438119|30|NZ_CP054043|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 7, identity: 0.767
ctccgttggcgtctcggtcggtgtctccgt CRISPR spacer
gacggttggcggctcggtcagtgtctcagg Protospacer
* ******* *******.******* *
125. spacer 2.20|4438275|30|NZ_CP054043|CRT matches to MH697580 (Gordonia phage Catfish, complete genome) position: , mismatch: 7, identity: 0.767
ctccgtcggcgtctccgttggtgtctccgt CRISPR spacer
tcgcgtcggcgtcgccgttggtgtccgcat Protospacer
.. ********** ***********. *.*
126. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.733
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
caaggtcggcgtgacggtcggcgtctgtta Protospacer
* ********* ************
127. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.733
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gcgcgtcgtcgtctcggtcagcgtctccat Protospacer
. **** **********.******* .*
128. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_022044 (Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence) position: , mismatch: 8, identity: 0.733
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
tctgctcggcgtctcggccggcgcctcgac Protospacer
...* ************.*****.****..
129. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.733
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gggggtcgacgtctcggtcggcggcttcgc Protospacer
*****.************** **. *.
130. spacer 2.9|4437735|30|NZ_CP054043|CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 8, identity: 0.733
ttccgttggcgtctcggttggcgtctcggt CRISPR spacer
cgccgtcggcgtctcggttggcggaaccgg Protospacer
. ****.**************** * *
131. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to NZ_CP026333 (Pseudomonas sp. XWY-1 plasmid pXWY, complete sequence) position: , mismatch: 8, identity: 0.733
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcttgtggcgtctcggtcgacgtctcctg Protospacer
. *. **************.*******
132. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to MN310371 (Pseudomonas monteilii strain QJ20133 plasmid pJ20133-VIM, complete sequence) position: , mismatch: 8, identity: 0.733
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
cgcttgtggcgtctcggtcgacgtctcctg Protospacer
. *. **************.*******
133. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to CP000877 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU02, complete sequence) position: , mismatch: 8, identity: 0.733
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
ctccgttggcgtattggtcggcgttggact Protospacer
.*********** *.*********. *
134. spacer 2.13|4437891|30|NZ_CP054043|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 8, identity: 0.733
ttccgttggcgtctcggtcggcgtctccgt CRISPR spacer
gaccgtcggcgtatcggtcggcgtcgggga Protospacer
****.***** ************ *
135. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
cccggtcggcgtcgcggtcggcgggcgcac Protospacer
*.*********** ********* . ..
136. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NC_008242 (Chelativorans sp. BNC1 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.7
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
gaggctcggcggctcggtcggcgtctgctg Protospacer
* ****** **************
137. spacer 2.5|4437555|30|NZ_CP054043|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.7
ctcggtcggcgtctcggtcggcgtctcggt CRISPR spacer
actggtcggcatctcggtcggcggcttctg Protospacer
..*******.************ **.
