Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP054063 Klebsiella pneumoniae strain WSHvKP chromosome, complete genome 3 crisprs csa3,WYL,RT,cas3,DEDDh,DinG 0 1 6 0
NZ_CP054064 Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence 1 crisprs NA 0 2 1 0

Results visualization

1. NZ_CP054064
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054064_1 148352-148508 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP031258 Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence 70026-70052 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 102859-102885 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 197593-197619 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP045662 Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence 103272-103298 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP031790 Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence 3073-3099 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 72330-72356 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 121087-121113 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 163365-163391 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP026166 Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence 198463-198489 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP052373 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence 49323-49349 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP023135 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence 73732-73758 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP018338 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence 186590-186616 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 196652-196678 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP054064 Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence 148391-148417 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MK715436 Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence 32204-32230 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 158570-158596 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP033758 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2 38300-38326 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP033758 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2 228826-228852 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP035203 Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence 44815-44841 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP031258 Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence 70069-70104 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 102807-102842 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 197541-197576 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP045662 Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence 103220-103255 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP031790 Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence 3116-3151 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 72278-72313 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 121035-121070 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 163313-163348 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 48752-48787 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 49221-49256 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 69200-69235 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 69669-69704 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP026166 Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence 198411-198446 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 47425-47460 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 47894-47929 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052373 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence 49366-49401 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP018338 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence 186633-186668 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 196695-196730 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP054064 Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence 148434-148469 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_MK715436 Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence 32247-32282 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP033758 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2 38248-38283 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP033758 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2 228774-228809 0 1.0
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP035203 Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence 44763-44798 0 1.0
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94088-94114 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 198305-198331 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 192965-192991 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 266196-266222 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 2385-2411 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 86292-86318 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 129491-129517 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 91199-91225 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 128426-128452 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NC_011282 Klebsiella variicola strain 342 plasmid pKP187, complete sequence 185489-185515 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP024517 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence 115959-115985 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP024497 Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence 115959-115985 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP024501 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence 115959-115985 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 128425-128451 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 99989-100015 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 107186-107212 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 190939-190965 1 0.963
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 127233-127259 1 0.963
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NC_011282 Klebsiella variicola strain 342 plasmid pKP187, complete sequence 184852-184887 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289477-289512 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289595-289630 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 290180-290215 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 290647-290682 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 182045-182080 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 182512-182547 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146828-146863 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 217614-217649 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 121937-121972 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 65826-65861 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 42322-42357 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 139862-139897 1 0.972
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 140329-140364 1 0.972
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 197602-197628 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 192262-192288 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 267016-267042 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 3205-3231 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NC_011282 Klebsiella variicola strain 342 plasmid pKP187, complete sequence 184552-184578 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP024517 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence 115138-115164 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP024497 Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence 115138-115164 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP024501 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence 115138-115164 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 99871-99897 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 100225-100251 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 106483-106509 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 190236-190262 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 85804-85830 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 26807-26833 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289293-289319 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289411-289437 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289529-289555 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289647-289673 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 MN310378 Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence 46228-46254 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 181979-182005 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 37836-37862 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 37954-37980 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 38072-38098 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146526-146552 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146644-146670 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146762-146788 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 48709-48735 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 49178-49204 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 49530-49556 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 68900-68926 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 69252-69278 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 69721-69747 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 201429-201455 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 217548-217574 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 191027-191053 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 191145-191171 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 191263-191289 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 279499-279525 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 279735-279761 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 213290-213316 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 213408-213434 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 213526-213552 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 194868-194894 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 47382-47408 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 47851-47877 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 48203-48229 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 52274-52300 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 52392-52418 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 52510-52536 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 66018-66044 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 66136-66162 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 172383-172409 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 172501-172527 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 172619-172645 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 42021-42047 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 42139-42165 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MH476540 Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence 64125-64151 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MG764552 Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence 38270-38296 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 139796-139822 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 227808-227834 2 0.926
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 228044-228070 2 0.926
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NC_011282 Klebsiella variicola strain 342 plasmid pKP187, complete sequence 184500-184535 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 181927-181962 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146592-146627 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146710-146745 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 217496-217531 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 66061-66096 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 42087-42122 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 139744-139779 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP023135 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence 73775-73810 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 MN310378 Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence 46271-46306 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_MH476540 Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence 64168-64203 2 0.944
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_MG764552 Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence 38313-38348 2 0.944
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 100107-100133 3 0.889
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146408-146434 3 0.889
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 49648-49674 3 0.889
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 68782-68808 3 0.889
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 201311-201337 3 0.889
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 279617-279643 3 0.889
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 48321-48347 3 0.889
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 66254-66280 3 0.889
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 41903-41929 3 0.889
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 227926-227952 3 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NC_011282 Klebsiella variicola strain 342 plasmid pKP187, complete sequence 185437-185472 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289713-289748 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146474-146509 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 201259-201294 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94131-94166 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 198253-198288 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 192913-192948 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 266239-266274 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 2428-2463 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 86335-86370 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 129439-129474 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 91242-91277 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 128374-128409 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP024517 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence 115907-115942 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP024497 Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence 115907-115942 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP024501 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence 115907-115942 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 195160-195195 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 195277-195312 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 195394-195429 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 128373-128408 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 99914-99949 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 107134-107169 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 190887-190922 3 0.917
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 127181-127216 3 0.917
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP031258 Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence 70495-70521 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP031258 Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence 70613-70639 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 MN543579 Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence 102390-102416 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 MN543581 Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence 197124-197150 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP045662 Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence 102803-102829 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP031790 Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence 3542-3568 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 LR134207 Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2 71861-71887 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 120618-120644 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 162896-162922 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP026166 Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence 197994-198020 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP023135 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence 74200-74226 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP023135 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence 74318-74344 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 CP023135 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence 74436-74462 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP018338 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence 187059-187085 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 197121-197147 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 197239-197265 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP054064 Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence 148860-148886 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP054064 Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence 148978-149004 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MK715436 Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence 32673-32699 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP033758 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2 37831-37857 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP035203 Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence 44346-44372 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 290698-290724 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 182563-182589 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 65784-65810 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 42373-42399 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 140380-140406 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_AP014639 Leptolyngbya boryana IAM M-101 plasmid pLBA 55859-55885 4 0.852
NZ_CP054064_1 1.1|148391|27|NZ_CP054064|PILER-CR 148391-148417 27 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 121895-121921 4 0.852
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 146356-146391 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 66297-66332 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 41851-41886 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94599-94634 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 95067-95102 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 95535-95570 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 197785-197820 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 192445-192480 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 266707-266742 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 2896-2931 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 86686-86721 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128035-128070 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128503-128538 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128971-129006 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 91710-91745 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 92178-92213 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 92646-92681 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 126970-127005 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 127321-127356 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 127672-127707 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 128023-128058 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 126969-127004 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 127437-127472 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 127905-127940 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 106783-106818 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 190419-190454 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 125777-125812 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 126128-126163 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 126479-126514 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 126830-126865 4 0.889
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP024517 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence 115439-115474 7 0.806
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP024497 Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence 115439-115474 7 0.806
NZ_CP054064_1 1.2|148457|36|NZ_CP054064|PILER-CR 148457-148492 36 NZ_CP024501 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence 115439-115474 7 0.806

1. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

2. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

3. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

4. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

5. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP031790 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

6. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

7. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

8. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

9. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

10. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

11. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

12. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

13. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

14. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

15. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MK715436 (Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

16. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

17. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

18. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

19. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatg	Protospacer
***************************

20. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

21. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

22. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

23. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

24. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP031790 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

25. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

26. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

27. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

28. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

29. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

30. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

31. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

32. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

33. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

34. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

35. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

36. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

37. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

38. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

39. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_MK715436 (Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

40. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

41. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

42. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgcct	Protospacer
************************************

43. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

44. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

45. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

46. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

47. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

48. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

49. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

50. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

51. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

52. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

53. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

54. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

55. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

56. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

57. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

58. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

59. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

60. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaaggtaatt	Protospacer
************************** 

61. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatagccggttatgccg	Protospacer
*********************************** 

62. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct	Protospacer
********************** *************

63. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct	Protospacer
********************** *************

64. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct	Protospacer
**************** *******************

65. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct	Protospacer
**************** *******************

66. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct	Protospacer
********************** *************

67. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct	Protospacer
**************** *******************

68. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct	Protospacer
********************** *************

69. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct	Protospacer
********************** *************

70. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct	Protospacer
**************** *******************

71. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct	Protospacer
**************** *******************

72. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct	Protospacer
**************** *******************

73. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgcct	Protospacer
********************** *************

74. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 1, identity: 0.972

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggcccggcatagccggttatgcct	Protospacer
**************** *******************

75. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

76. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

77. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

78. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

79. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

80. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

81. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

82. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

83. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

84. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggaaaggttctgaaaggtaatt	Protospacer
******** ***************** 

85. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

86. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

87. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

88. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

89. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

90. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

91. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

92. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

93. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

94. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

95. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

96. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

97. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

98. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

99. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

100. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

101. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

102. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

103. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

104. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

105. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

106. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

107. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

108. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

109. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

110. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

111. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

112. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

113. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

114. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

115. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

116. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

117. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

118. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

119. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

120. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

121. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

122. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

123. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

124. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

125. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

126. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

127. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

128. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

129. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

130. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

131. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MH476540 (Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

132. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MG764552 (Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

133. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

134. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

135. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaagataatt	Protospacer
*********************.**** 

136. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgccg	Protospacer
********************** ************ 

137. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct	Protospacer
****************.***** *************

138. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct	Protospacer
****************.***** *************

139. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct	Protospacer
****************.***** *************

140. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct	Protospacer
****************.***** *************

141. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct	Protospacer
****************.***** *************

142. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct	Protospacer
****************.***** *************

143. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct	Protospacer
****************.***** *************

144. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatagccggttatgccc	Protospacer
****************.******************.

145. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct	Protospacer
****************.***** *************

146. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_MH476540 (Klebsiella pneumoniae strain KP1276 plasmid pIA/C-KLUC, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct	Protospacer
****************.***** *************

147. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_MG764552 (Klebsiella pneumoniae strain A1763 plasmid pA1763-Ct2, complete sequence) position: , mismatch: 2, identity: 0.944

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgcct	Protospacer
****************.***** *************

148. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 3, identity: 0.889

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctggaagataatt	Protospacer
*****************.***.**** 

149. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 3, identity: 0.889

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaacggataggttctgaaagataatt	Protospacer
*** *****************.**** 

150. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 3, identity: 0.889

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggtaaggttctgaaaggtaatt	Protospacer
*******  ***************** 

151. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 3, identity: 0.889

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggtaaggttctgaaaggtaatt	Protospacer
*******  ***************** 

152. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 3, identity: 0.889

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaacggataggttctgaaagataatt	Protospacer
*** *****************.**** 

153. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.889

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtactggataggttctgaaagataatt	Protospacer
****.****************.**** 

154. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 3, identity: 0.889

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggtaaggttctgaaaggtaatt	Protospacer
*******  ***************** 

155. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 3, identity: 0.889

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaacggataggttctgaaagataatt	Protospacer
*** *****************.**** 

156. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 3, identity: 0.889

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaacggataggttctgaaagataatt	Protospacer
*** *****************.**** 

157. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.889

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtactggataggttctgaaagataatt	Protospacer
****.****************.**** 

158. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

159. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

160. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgccg	Protospacer
****************.***** ************ 

161. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccgggcatcgccggttatgccg	Protospacer
****************.***** ************ 

162. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

163. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

164. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

165. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

166. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

167. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

168. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

169. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

170. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

171. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

172. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

173. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

174. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatgtcg	Protospacer
********************** **********.* 

175. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

176. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

177. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

178. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

179. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

180. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

181. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttctgccg	Protospacer
********************** ******* **** 

182. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

183. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

184. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

185. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

186. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

187. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP031790 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

188. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

189. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

190. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

191. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

192. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

193. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

194. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

195. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

196. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

197. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

198. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

199. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

200. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MK715436 (Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

201. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

202. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
acaccgggtaggttctgaaaggcaatg	Protospacer
..*****.**************.****

203. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaggtaattg	Protospacer
*******************.*  * **

204. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaggtaattg	Protospacer
*******************.*  * **

205. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaggtaattg	Protospacer
*******************.*  * **

206. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaggtaattg	Protospacer
*******************.*  * **

207. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaggtaattg	Protospacer
*******************.*  * **

208. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_AP014639 (Leptolyngbya boryana IAM M-101 plasmid pLBA) position: , mismatch: 4, identity: 0.852

-gtaccggataggttctgaaaggtaatg	CRISPR spacer
tgtatt-gataggttctgaaagttaatg	Protospacer
 ***.. *************** *****

209. spacer 1.1|148391|27|NZ_CP054064|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 4, identity: 0.852

gtaccggataggttctgaaaggtaatg	CRISPR spacer
gtaccggataggttctgaaggtaattg	Protospacer
*******************.*  * **

210. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatcaca	Protospacer
********************** *********  * 

211. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatcaca	Protospacer
********************** *********  * 

212. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gtgcggttgaatggccaggcatcgccggttatcaca	Protospacer
********************** *********  * 

213. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

214. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

215. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

216. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

217. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

218. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

219. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

220. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

221. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

222. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

223. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

224. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

225. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

226. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

227. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

228. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

229. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

230. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

231. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

232. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

233. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

234. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

235. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

236. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

237. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

238. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

239. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 4, identity: 0.889

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatgcct	Protospacer
*. *****.************* *************

240. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.806

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatcaca	Protospacer
*. *****.************* *********  * 

241. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatcaca	Protospacer
*. *****.************* *********  * 

242. spacer 1.2|148457|36|NZ_CP054064|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.806

gtgcggttgaatggccaggcatagccggttatgcct	CRISPR spacer
gcccggttaaatggccaggcatcgccggttatcaca	Protospacer
*. *****.************* *********  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 93769 : 143536 38 Salmonella_phage(13.33%) transposase,integrase attL 134564:134578|attR 147652:147666
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP054063
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054063_1 3450934-3451016 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054063_2 4038305-4038444 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP054063_3 4255307-4255401 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP054063_1 1.1|3450962|27|NZ_CP054063|CRISPRCasFinder 3450962-3450988 27 NZ_CP015439 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_1, complete sequence 57276-57302 5 0.815

1. spacer 1.1|3450962|27|NZ_CP054063|CRISPRCasFinder matches to NZ_CP015439 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_1, complete sequence) position: , mismatch: 5, identity: 0.815

tgctattgcgcgattattttgccgggt	CRISPR spacer
agctattgcgcgactatgttgccgtgc	Protospacer
 ************.*** ****** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1162763 : 1213283 65 Salmonella_phage(83.33%) plate,terminase,tail,integrase,tRNA,capsid,portal,lysis,head,transposase attL 1164233:1164279|attR 1201909:1201955
DBSCAN-SWA_2 1664412 : 1671317 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_3 1714662 : 1725517 9 Enterobacteria_phage(22.22%) transposase NA
DBSCAN-SWA_4 1927510 : 1982492 46 Staphylococcus_phage(25.0%) plate,transposase,protease NA
DBSCAN-SWA_5 2639221 : 2650108 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_6 3312266 : 3321730 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage