Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP052074 Ralstonia solanacearum strain FJAT448.F1 chromosome, complete genome 1 crisprs RT,cas3,WYL,csa3,DEDDh,DinG 0 1 13 0

Results visualization

1. NZ_CP052074
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP052074_1 2319601-2319711 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP052074_1 1.1|2319628|57|NZ_CP052074|CRISPRCasFinder 2319628-2319684 57 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1200220-1200276 0 1.0

1. spacer 1.1|2319628|57|NZ_CP052074|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 0, identity: 1.0

tgggaagcgctgttggcggcgcgcccggacggggcgccctgctccggcagcggaggc	CRISPR spacer
tgggaagcgctgttggcggcgcgcccggacggggcgccctgctccggcagcggaggc	Protospacer
*********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 215325 : 248278 43 Acidithiobacillus_phage(56.25%) portal,terminase,transposase,head,capsid NA
DBSCAN-SWA_2 253306 : 335481 60 Ralstonia_phage(33.33%) protease,transposase,tail NA
DBSCAN-SWA_3 868971 : 922445 51 Lactobacillus_phage(16.67%) coat,transposase,protease NA
DBSCAN-SWA_4 939451 : 949590 9 Hokovirus(14.29%) NA NA
DBSCAN-SWA_5 1560151 : 1637956 83 Ralstonia_phage(44.23%) portal,holin,tail,tRNA,terminase,integrase,transposase,head,plate,capsid attL 1565894:1565913|attR 1650114:1650133
DBSCAN-SWA_6 1830245 : 1969805 150 Pseudomonas_phage(12.96%) portal,tail,tRNA,integrase,terminase,transposase,plate,protease,capsid,head attL 1840086:1840102|attR 1901704:1902919
DBSCAN-SWA_7 2153002 : 2160309 12 Ralstonia_phage(100.0%) coat NA
DBSCAN-SWA_8 2536587 : 2622396 88 Ralstonia_phage(36.96%) portal,holin,tail,tRNA,terminase,integrase,plate,protease,capsid,head attL 2568249:2568273|attR 2610740:2610764
DBSCAN-SWA_9 2686896 : 2759359 74 Ralstonia_phage(30.3%) portal,tail,terminase,integrase,transposase,head,protease,capsid attL 2695310:2695358|attR 2744122:2744170
DBSCAN-SWA_10 2882822 : 2891058 8 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_11 2933938 : 2948044 12 Ralstonia_phage(55.56%) tail NA
DBSCAN-SWA_12 2955861 : 3007569 58 Acidithiobacillus_phage(45.45%) portal,terminase,transposase,capsid,head NA
DBSCAN-SWA_13 3794086 : 3857573 48 Klosneuvirus(22.22%) holin,protease,transposase,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP052075
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29663 : 41755 11 Ralstonia_phage(42.86%) NA NA
DBSCAN-SWA_2 699678 : 731202 31 Ralstonia_phage(27.27%) transposase NA
DBSCAN-SWA_3 1095180 : 1106075 10 Ralstonia_phage(25.0%) transposase NA
DBSCAN-SWA_4 1272230 : 1322933 35 uncultured_Caudovirales_phage(28.57%) transposase,plate,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage