Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP050185 Bacillus thuringiensis strain HER1410 plasmid pLUSID2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP050186 Bacillus thuringiensis strain HER1410 plasmid pLUSID3, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP050184 Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence 0 crisprs csa3,cas14j,RT 0 0 4 0
NZ_CP050183 Bacillus thuringiensis strain HER1410 chromosome, complete genome 5 crisprs cas3,csa3,RT,WYL,DinG,cas14k,DEDDh 2 8 25 0

Results visualization

1. NZ_CP050185
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 46204 : 126953 77 Bacillus_phage(41.46%) transposase,holin,integrase,portal,terminase,protease,capsid,coat,tail,tRNA,head attL 45843:45902|attR 125362:127104

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP050186
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 55 : 30036 43 Bacillus_phage(37.14%) protease,capsid,terminase,head,tail,portal NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP050184
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 110917 : 190412 56 Bacillus_phage(33.33%) integrase,transposase attL 189228:189243|attR 190840:190855
DBSCAN-SWA_2 202603 : 240930 32 Bacillus_phage(75.0%) integrase,transposase,protease attL 192972:192987|attR 225800:225815
DBSCAN-SWA_3 254960 : 335587 53 Streptococcus_phage(25.0%) transposase,protease NA
DBSCAN-SWA_4 349472 : 359897 13 Bacillus_phage(76.92%) transposase,holin NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP050183
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050183_1 1667951-1668033 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050183_2 2360460-2360553 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050183_3 3242826-3243349 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050183_4 4487112-4487839 Orphan NA
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP050183_5 5362794-5362927 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP050183_4 4.8|4487606|19|NZ_CP050183|CRT 4487606-4487624 19 NZ_CP050183.1 4487111-4487129 0 1.0
NZ_CP050183_4 4.8|4487606|19|NZ_CP050183|CRT 4487606-4487624 19 NZ_CP050183.1 2323554-2323572 1 0.947
NZ_CP050183_4 4.8|4487606|19|NZ_CP050183|CRT 4487606-4487624 19 NZ_CP050183.1 2323617-2323635 1 0.947
NZ_CP050183_4 4.8|4487606|19|NZ_CP050183|CRT 4487606-4487624 19 NZ_CP050183.1 2323689-2323707 1 0.947
NZ_CP050183_4 4.8|4487606|19|NZ_CP050183|CRT 4487606-4487624 19 NZ_CP050183.1 2323707-2323725 1 0.947
NZ_CP050183_4 4.8|4487606|19|NZ_CP050183|CRT 4487606-4487624 19 NZ_CP050183.1 2323449-2323467 2 0.895
NZ_CP050183_4 4.9|4487660|19|NZ_CP050183|CRT 4487660-4487678 19 NZ_CP050183.1 1520136-1520154 2 0.895
NZ_CP050183_4 4.9|4487660|19|NZ_CP050183|CRT 4487660-4487678 19 NZ_CP050183.1 2323599-2323617 2 0.895
NZ_CP050183_4 4.9|4487660|19|NZ_CP050183|CRT 4487660-4487678 19 NZ_CP050183.1 2323725-2323743 2 0.895
NZ_CP050183_4 4.9|4487660|19|NZ_CP050183|CRT 4487660-4487678 19 NZ_CP050183.1 3245780-3245798 2 0.895
NZ_CP050183_4 4.9|4487660|19|NZ_CP050183|CRT 4487660-4487678 19 NZ_CP050183.1 4555135-4555153 2 0.895
NZ_CP050183_4 4.9|4487660|19|NZ_CP050183|CRT 4487660-4487678 19 NZ_CP050183.1 4684997-4685015 2 0.895
NZ_CP050183_4 4.9|4487660|19|NZ_CP050183|CRT 4487660-4487678 19 NZ_CP050183.1 4686017-4686035 2 0.895

1. spacer 4.8|4487606|19|NZ_CP050183|CRT matches to position: 4487111-4487129, mismatch: 0, identity: 1.0 

tgttgctcctgttgggcct	CRISPR spacer
tgttgctcctgttgggcct	Protospacer
*******************

2. spacer 4.8|4487606|19|NZ_CP050183|CRT matches to position: 2323554-2323572, mismatch: 1, identity: 0.947 

tgttgctcctgttgggcct	CRISPR spacer
tgtcgctcctgttgggcct	Protospacer
***.***************

3. spacer 4.8|4487606|19|NZ_CP050183|CRT matches to position: 2323617-2323635, mismatch: 1, identity: 0.947 

tgttgctcctgttgggcct	CRISPR spacer
tgttgctcccgttgggcct	Protospacer
*********.*********

4. spacer 4.8|4487606|19|NZ_CP050183|CRT matches to position: 2323689-2323707, mismatch: 1, identity: 0.947 

tgttgctcctgttgggcct	CRISPR spacer
tgttgctcctgttggacct	Protospacer
***************.***

5. spacer 4.8|4487606|19|NZ_CP050183|CRT matches to position: 2323707-2323725, mismatch: 1, identity: 0.947 

tgttgctcctgttgggcct	CRISPR spacer
tgttgctcctgttggacct	Protospacer
***************.***

6. spacer 4.8|4487606|19|NZ_CP050183|CRT matches to position: 2323449-2323467, mismatch: 2, identity: 0.895 

tgttgctcctgttgggcct	CRISPR spacer
tgttggacctgttgggcct	Protospacer
*****  ************

7. spacer 4.9|4487660|19|NZ_CP050183|CRT matches to position: 1520136-1520154, mismatch: 2, identity: 0.895 

tgttgctcctgttattcct	CRISPR spacer
tgttgatcctgttaatcct	Protospacer
***** ******** ****

8. spacer 4.9|4487660|19|NZ_CP050183|CRT matches to position: 2323599-2323617, mismatch: 2, identity: 0.895 

tgttgctcctgttattcct	CRISPR spacer
tgttgctcctgttaaacct	Protospacer
**************  ***

9. spacer 4.9|4487660|19|NZ_CP050183|CRT matches to position: 2323725-2323743, mismatch: 2, identity: 0.895 

tgttgctcctgttattcct	CRISPR spacer
tgttgctcctgttaaacct	Protospacer
**************  ***

10. spacer 4.9|4487660|19|NZ_CP050183|CRT matches to position: 3245780-3245798, mismatch: 2, identity: 0.895 

tgttgctcctgttattcct	CRISPR spacer
tgttgctcccgttatacct	Protospacer
*********.***** ***

11. spacer 4.9|4487660|19|NZ_CP050183|CRT matches to position: 4555135-4555153, mismatch: 2, identity: 0.895 

tgttgctcctgttattcct	CRISPR spacer
tgttgctcctgtaaatcct	Protospacer
************ * ****

12. spacer 4.9|4487660|19|NZ_CP050183|CRT matches to position: 4684997-4685015, mismatch: 2, identity: 0.895 

tgttgctcctgttattcct	CRISPR spacer
tgttgctcccgttatccct	Protospacer
*********.*****.***

13. spacer 4.9|4487660|19|NZ_CP050183|CRT matches to position: 4686017-4686035, mismatch: 2, identity: 0.895 

tgttgctcctgttattcct	CRISPR spacer
tgttgctcccgttatccct	Protospacer
*********.*****.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP050183_4 4.2|4487201|37|NZ_CP050183|CRT 4487201-4487237 37 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 73753-73789 5 0.865
NZ_CP050183_4 4.4|4487327|28|NZ_CP050183|CRT 4487327-4487354 28 MN694403 Marine virus AFVG_250M373, complete genome 19505-19532 5 0.821
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_AP014865 Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence 291095-291127 6 0.818
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP022446 Bacillus cereus C1L plasmid pC1L1, complete sequence 276121-276153 6 0.818
NZ_CP050183_4 4.2|4487201|37|NZ_CP050183|CRT 4487201-4487237 37 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 73645-73681 6 0.838
NZ_CP050183_4 4.6|4487444|37|NZ_CP050183|CRT 4487444-4487480 37 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 142-178 6 0.838
NZ_CP050183_4 4.6|4487444|37|NZ_CP050183|CRT 4487444-4487480 37 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 241-277 6 0.838
NZ_CP050183_4 4.6|4487444|37|NZ_CP050183|CRT 4487444-4487480 37 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321869-321905 6 0.838
NZ_CP050183_4 4.10|4487714|28|NZ_CP050183|CRT 4487714-4487741 28 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 71377-71404 6 0.786
NZ_CP050183_4 4.11|4487777|28|NZ_CP050183|CRT 4487777-4487804 28 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 71377-71404 6 0.786
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP004874 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB74, complete sequence 61767-61799 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP015154 Bacillus thuringiensis strain Bc601 plasmid pBTBC4, complete sequence 14101-14133 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP013059 Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-4, complete sequence 17511-17543 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP044980 Bacillus thuringiensis strain BT62 plasmid pBT62B, complete sequence 150180-150212 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP007513 Bacillus bombysepticus plasmid pBb, complete genome 351655-351687 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_AP014865 Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence 399923-399955 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP053952 Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence 163715-163747 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP053953 Bacillus cereus strain FDAARGOS_798 plasmid unnamed2, complete sequence 73525-73557 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP050184 Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence 295528-295560 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP050184 Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence 357192-357224 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_MG710485 Bacillus thuringiensis serovar israelensis strain Bti-UFT6.51 plasmid pBtiUFT6.51.1 complete sequence 61623-61655 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP053949 Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence 293865-293897 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP053950 Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence 295895-295927 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP011351 Bacillus thuringiensis strain YC-10 plasmid pYC3, complete sequence 71306-71338 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 155001-155033 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_AP014866 Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK2, complete sequence 257924-257956 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 NZ_CP011156 Bacillus cereus strain HN001 plasmid pRML01, complete sequence 382012-382044 7 0.788
NZ_CP050183_1 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder 1667976-1668008 33 CP016196 Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence 76590-76622 7 0.788
NZ_CP050183_5 5.1|5362817|31|NZ_CP050183|CRISPRCasFinder 5362817-5362847 31 MN693297 Marine virus AFVG_25M423, complete genome 23702-23732 7 0.774
NZ_CP050183_5 5.1|5362817|31|NZ_CP050183|CRISPRCasFinder 5362817-5362847 31 MN693353 Marine virus AFVG_25M425, complete genome 3123-3153 7 0.774
NZ_CP050183_5 5.1|5362817|31|NZ_CP050183|CRISPRCasFinder 5362817-5362847 31 MN693440 Marine virus AFVG_25M540, complete genome 23575-23605 8 0.742
NZ_CP050183_4 4.6|4487444|37|NZ_CP050183|CRT 4487444-4487480 37 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 73942-73978 9 0.757
NZ_CP050183_3 3.7|3243242|34|NZ_CP050183|CRT 3243242-3243275 34 MT820023 Cryophage ML09, complete genome 23671-23704 12 0.647

1. spacer 4.2|4487201|37|NZ_CP050183|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.865 

tgttgctcctgttattcctgtcgctcccgttggacct	CRISPR spacer
tgttactcctgttattcctgttgctcccgttgctccg	Protospacer
****.****************.**********  **

2. spacer 4.4|4487327|28|NZ_CP050183|CRT matches to MN694403 (Marine virus AFVG_250M373, complete genome) position: , mismatch: 5, identity: 0.821 

tgttggacctgttgaacccgtcgctccc	CRISPR spacer
tgttggccctgttgaacccgttggccct	Protospacer
****** **************.* .**.

3. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_AP014865 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence) position: , mismatch: 6, identity: 0.818 

agagtattatgccacggccttttctgtactgac----	CRISPR spacer
agagtattatgccacggccttttc----ccgatattt	Protospacer
************************    *.**.

4. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP022446 (Bacillus cereus C1L plasmid pC1L1, complete sequence) position: , mismatch: 6, identity: 0.818 

agagtattatgccacggccttttc---tgtactgac	CRISPR spacer
agagtattatgccacggccatttcatatgtttt---	Protospacer
******************* ****   *** .*

5. spacer 4.2|4487201|37|NZ_CP050183|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.838 

tgttgctcctgttattcctgtcgctcccgttggacct	CRISPR spacer
cgttgctccggttactcctgtcgctcccgttgctccc	Protospacer
.******** ****.*****************  **.

6. spacer 4.6|4487444|37|NZ_CP050183|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 6, identity: 0.838 

cgttgctcccgttactcctgtcgcccccgttggaccc	CRISPR spacer
tgttgctcccgttactcctgttgctcccgttgctcct	Protospacer
.********************.**.*******  **.

7. spacer 4.6|4487444|37|NZ_CP050183|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 6, identity: 0.838 

cgttgctcccgttactcctgtcgcccccgttggaccc	CRISPR spacer
tgttgctcccgttactcctgttgctcccgttgctcct	Protospacer
.********************.**.*******  **.

8. spacer 4.6|4487444|37|NZ_CP050183|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 6, identity: 0.838 

cgttgctcccgttactcctgtcgcccccgttggaccc	CRISPR spacer
tgttgctcccgttactcctgttgctcccgttgctcct	Protospacer
.********************.**.*******  **.

9. spacer 4.10|4487714|28|NZ_CP050183|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786 

tgtcgctcccgttgcccctgttattcct	CRISPR spacer
cgtcgctcccgttgctcctgtttcacca	Protospacer
.**************.****** . **

10. spacer 4.11|4487777|28|NZ_CP050183|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786 

tgtcgctcccgttgcccctgttattcct	CRISPR spacer
cgtcgctcccgttgctcctgtttcacca	Protospacer
.**************.****** . **

11. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP004874 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB74, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

12. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP015154 (Bacillus thuringiensis strain Bc601 plasmid pBTBC4, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

13. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP013059 (Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-4, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

14. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP044980 (Bacillus thuringiensis strain BT62 plasmid pBT62B, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

15. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP007513 (Bacillus bombysepticus plasmid pBb, complete genome) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

16. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_AP014865 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

17. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP053952 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

18. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP053953 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

19. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP050184 (Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

20. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP050184 (Bacillus thuringiensis strain HER1410 plasmid pLUSID1, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

21. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_MG710485 (Bacillus thuringiensis serovar israelensis strain Bti-UFT6.51 plasmid pBtiUFT6.51.1 complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

22. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP053949 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

23. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP053950 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

24. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP011351 (Bacillus thuringiensis strain YC-10 plasmid pYC3, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

25. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

26. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_AP014866 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK2, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

27. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

28. spacer 1.1|1667976|33|NZ_CP050183|CRISPRCasFinder matches to CP016196 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence) position: , mismatch: 7, identity: 0.788 

agagtattatgccacggccttttctgtactgac	CRISPR spacer
agagtattatgccacggccttttcccgatattc	Protospacer
************************.  *.   *

29. spacer 5.1|5362817|31|NZ_CP050183|CRISPRCasFinder matches to MN693297 (Marine virus AFVG_25M423, complete genome) position: , mismatch: 7, identity: 0.774 

ttcttcttttttgtcaccagttgaaccgctt	CRISPR spacer
ttcaaattttctgtcacctgttgaaccgccc	Protospacer
***   ****.******* **********..

30. spacer 5.1|5362817|31|NZ_CP050183|CRISPRCasFinder matches to MN693353 (Marine virus AFVG_25M425, complete genome) position: , mismatch: 7, identity: 0.774 

ttcttcttttttgtcaccagttgaaccgctt	CRISPR spacer
ttcaaattttctgtcacctgttgaaccgccc	Protospacer
***   ****.******* **********..

31. spacer 5.1|5362817|31|NZ_CP050183|CRISPRCasFinder matches to MN693440 (Marine virus AFVG_25M540, complete genome) position: , mismatch: 8, identity: 0.742 

ttcttcttttttgtcaccagttgaaccgctt	CRISPR spacer
ctcaaattttctgtcacctgttgaaccgccc	Protospacer
.**   ****.******* **********..

32. spacer 4.6|4487444|37|NZ_CP050183|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.757 

cgttgctcccgttactcctgtcgcccccgttggaccc	CRISPR spacer
tgttgctcccattactcctgtcgctccagctactcct	Protospacer
.*********.*************.** *.*.  **.

33. spacer 3.7|3243242|34|NZ_CP050183|CRT matches to MT820023 (Cryophage ML09, complete genome) position: , mismatch: 12, identity: 0.647 

ggttgggcctatacttccttgtggtccctgaata	CRISPR spacer
ttgtgcgcctgtacttccttgtggtcctacgggg	Protospacer
   ** ****.****************.  .. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14944 : 76633 53 Streptococcus_phage(26.67%) transposase,tRNA NA
DBSCAN-SWA_2 209324 : 267175 55 Streptococcus_phage(36.36%) protease,transposase NA
DBSCAN-SWA_3 289402 : 297349 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_4 346784 : 355160 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_5 395691 : 409888 24 Bacillus_phage(84.21%) integrase,transposase attL 392624:392640|attR 407839:407855
DBSCAN-SWA_6 964049 : 967038 6 Bacillus_phage(100.0%) integrase attL 963983:964002|attR 967894:967913
DBSCAN-SWA_7 1367453 : 1412444 44 Bacillus_phage(35.71%) protease,transposase,integrase attL 1363468:1363488|attR 1387727:1387747
DBSCAN-SWA_8 1432330 : 1439698 8 Bacillus_phage(16.67%) transposase NA
DBSCAN-SWA_9 1701768 : 1768565 57 Streptococcus_phage(28.57%) transposase NA
DBSCAN-SWA_10 1872837 : 1881518 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_11 1916627 : 1964371 51 Streptococcus_phage(20.0%) protease,transposase,coat NA
DBSCAN-SWA_12 2078154 : 2140089 55 Staphylococcus_phage(30.0%) bacteriocin,transposase,tRNA NA
DBSCAN-SWA_13 2345129 : 2352203 8 Bacillus_phage(28.57%) transposase NA
DBSCAN-SWA_14 2468803 : 2530781 54 Bacillus_phage(33.33%) transposase,tRNA NA
DBSCAN-SWA_15 2607334 : 2660920 57 Bacillus_phage(27.27%) bacteriocin,transposase NA
DBSCAN-SWA_16 2754991 : 2809263 60 Bacillus_phage(44.44%) transposase,coat NA
DBSCAN-SWA_17 2977357 : 3099540 110 Streptococcus_phage(20.83%) transposase,coat NA
DBSCAN-SWA_18 3306628 : 3335238 31 Staphylococcus_phage(37.5%) transposase NA
DBSCAN-SWA_19 3633207 : 3643365 14 Bacillus_phage(54.55%) bacteriocin NA
DBSCAN-SWA_20 4327156 : 4431403 114 Bacillus_phage(42.62%) head,terminase,tail,transposase,protease,holin,coat,tRNA,capsid,portal NA
DBSCAN-SWA_21 4495715 : 4503401 10 Staphylococcus_phage(16.67%) NA NA
DBSCAN-SWA_22 4857697 : 4950425 101 Bacillus_phage(67.24%) head,terminase,tail,protease,transposase,holin,coat,tRNA,capsid,integrase,plate,portal attL 4887949:4887964|attR 4923969:4923984
DBSCAN-SWA_23 5058506 : 5133983 89 Bacillus_phage(74.07%) head,terminase,tail,transposase,protease,holin,tRNA,capsid,integrase,plate,portal attL 5061897:5061916|attR 5134277:5134296
DBSCAN-SWA_24 5144622 : 5193747 64 Bacillus_phage(46.15%) head,terminase,tail,transposase,protease,holin,capsid,integrase,portal attL 5144319:5144339|attR 5189146:5189166
DBSCAN-SWA_25 5517750 : 5553250 27 Tupanvirus(15.38%) transposase,holin NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage