Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053803 Vibrio cholerae strain L6G chromosome 2, complete sequence 0 crisprs csa3,RT,cas3 0 0 2 0
NZ_CP053802 Vibrio cholerae strain L6G chromosome 1, complete sequence 1 crisprs cas3,DEDDh,DinG,csx1,csa3 0 1 3 0

Results visualization

1. NZ_CP053803
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 218609 : 227958 6 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_2 504155 : 510278 10 Escherichia_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053802
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053802_1 2467297-2467540 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053802_1 1.1|2467346|37|NZ_CP053802|PILER-CR 2467346-2467382 37 NC_049942 Escherichia phage JLK-2012, complete sequence 23524-23560 4 0.892
NZ_CP053802_1 1.1|2467346|37|NZ_CP053802|PILER-CR 2467346-2467382 37 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35464 4 0.892

1. spacer 1.1|2467346|37|NZ_CP053802|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
caggtcgccagttcgattccggtagccggcaccatat	Protospacer
.*********************.***********. *

2. spacer 1.1|2467346|37|NZ_CP053802|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
taggtcaccagttcgattccggtagccggcaccaatc	Protospacer
******.***************.*********** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 653892 : 660509 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 2169631 : 2176824 9 Anguillid_herpesvirus(16.67%) NA NA
DBSCAN-SWA_3 2406681 : 2413906 6 uncultured_Mediterranean_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage