Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP053815 Vibrio cholerae strain W7G plasmid pW7G, complete sequence 0 crisprs DinG 0 0 0 0
NZ_CP053813 Vibrio cholerae strain W7G chromosome 1, complete sequence 2 crisprs cas3,DEDDh,DinG,csx1,csa3 0 1 3 0
NZ_CP053814 Vibrio cholerae strain W7G chromosome 2, complete sequence 1 crisprs RT,csa3,cas3 0 0 0 0

Results visualization

1. NZ_CP053813
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053813_1 2046111-2046406 Orphan NA
2 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053813_2 2598382-2598625 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP053813_2 2.1|2598431|37|NZ_CP053813|PILER-CR 2598431-2598467 37 NC_049942 Escherichia phage JLK-2012, complete sequence 23524-23560 4 0.892
NZ_CP053813_2 2.1|2598431|37|NZ_CP053813|PILER-CR 2598431-2598467 37 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35464 4 0.892

1. spacer 2.1|2598431|37|NZ_CP053813|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
caggtcgccagttcgattccggtagccggcaccatat	Protospacer
.*********************.***********. *

2. spacer 2.1|2598431|37|NZ_CP053813|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
taggtcaccagttcgattccggtagccggcaccaatc	Protospacer
******.***************.*********** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 653332 : 659949 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 1570306 : 1593396 15 Vibrio_phage(76.92%) NA NA
DBSCAN-SWA_3 2537797 : 2545022 6 uncultured_Mediterranean_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP053814
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP053814_1 757363-757498 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage