1. spacer 1.7|2565814|21|NZ_LN832559|CRT matches to NZ_CP047896 (Sphingomonas sp. C33 plasmid pC33, complete sequence) position: , mismatch: 1, identity: 0.952
cttcccggttccggcggcacc CRISPR spacer
cttcccggttcctgcggcacc Protospacer
************ ********
2. spacer 1.11|2565992|20|NZ_LN832559|CRT matches to NZ_CP043475 (Mycobacterium grossiae strain DSM 104744 plasmid pGP01, complete sequence) position: , mismatch: 1, identity: 0.95
ccagcgttgcgcggcggtgc CRISPR spacer
ccagcgttgcgcggcggtgt Protospacer
*******************.
3. spacer 1.11|2565992|20|NZ_LN832559|CRT matches to NZ_CP043475 (Mycobacterium grossiae strain DSM 104744 plasmid pGP01, complete sequence) position: , mismatch: 1, identity: 0.95
ccagcgttgcgcggcggtgc CRISPR spacer
ccagcgttgcgcggcggtgt Protospacer
*******************.
4. spacer 1.11|2565992|20|NZ_LN832559|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 1, identity: 0.95
ccagcgttgcgcggcggtgc CRISPR spacer
ccagcgttgcgcggcggtgt Protospacer
*******************.
5. spacer 1.5|2565731|22|NZ_LN832559|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
tcccgcggttccggcggccgcc CRISPR spacer
ggccgcggttccggcggccgcc Protospacer
********************
6. spacer 1.2|2565609|24|NZ_LN832559|CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 4, identity: 0.833
gatgccgccgatcagatacgatga CRISPR spacer
gatgccgccgatcagataccgagg Protospacer
******************* . *.
7. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 4, identity: 0.857
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
ctcggcgaaatcggcggcgcccgccaga Protospacer
************* ********* **
8. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 4, identity: 0.857
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
ctcggcgaaatcggcggcgcccgccaga Protospacer
************* ********* **
9. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 4, identity: 0.857
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
ctcggcgaaatcggcggcgcccgccaga Protospacer
************* ********* **
10. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 4, identity: 0.857
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
ctccgcgaaatcgccgccgcccggcacg Protospacer
*** ************ *********.
11. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NC_048850 (Mycobacterium phage Cornie, complete genome) position: , mismatch: 4, identity: 0.857
ctcggcgaaatcgccggcgcccggcatc-- CRISPR spacer
ctcggcggaatcgccggcgcc--gcacccg Protospacer
*******.************* ***.*
12. spacer 4.2|3050314|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 4, identity: 0.871
gtggacggtgtcgttgccgccttgcccggag-- CRISPR spacer
gtggacggtgtagttgccgtcttg--cggagtt Protospacer
*********** *******.**** *****
13. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP040762 (Paracoccus sp. 2251 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.871
-aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gaagtagag-gtcgttgcccaggccgccatgc Protospacer
***.** * ********* ************
14. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 4, identity: 0.871
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
cgtcagcacgtcgtcgccgtcgccgcccatc Protospacer
******* *******************..*
15. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to MH791406 (UNVERIFIED: Pseudomonas phage PaSz-4, complete genome) position: , mismatch: 4, identity: 0.871
agtcagc-aggtcgtcgccgtcgccgcccgcc CRISPR spacer
-gtgagcaaggcggtcgccgtcgccgcccgcc Protospacer
** *** ***. *******************
16. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to KX198613 (Pseudomonas phage AN14, complete genome) position: , mismatch: 4, identity: 0.871
agtcagc-aggtcgtcgccgtcgccgcccgcc CRISPR spacer
-gtgagcaaggcggtcgccgtcgccgcccgcc Protospacer
** *** ***. *******************
17. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to DI373492 (KR 1020130142837-A/6: Bacteriophage of Pseudomonas aeruginosa and uses thereof) position: , mismatch: 4, identity: 0.871
agtcagc-aggtcgtcgccgtcgccgcccgcc CRISPR spacer
-gtgagcaaggcggtcgccgtcgccgcccgcc Protospacer
** *** ***. *******************
18. spacer 1.4|2565688|25|NZ_LN832559|CRT matches to NZ_CP029836 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.8
gatgccgccaccccatacggcgggt CRISPR spacer
cgtgccgccaccccagacggcggcc Protospacer
.************* ******* .
19. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.821
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
ctcggcgaaatcgacggcgccgggccgg Protospacer
************* ******* ***
20. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NC_014819 (Asticcacaulis excentricus CB 48 plasmid pASTEX02, complete sequence) position: , mismatch: 5, identity: 0.821
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
cacggcgacatcgctggcgcccggcagt Protospacer
* ****** *****.*********** .
21. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 5, identity: 0.821
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
ttcggcgaattcgtcggcgcccggcgtg Protospacer
.******** ***.***********.*
22. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 5, identity: 0.821
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
cttcacgaaatcgcccgcgcccggcaac Protospacer
**. .********** ********** *
23. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 5, identity: 0.839
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggacaggaagtcgtcgccctcgccgccctta Protospacer
** **** ******************* *
24. spacer 4.2|3050314|31|NZ_LN832559|CRISPRCasFinder matches to NC_018580 (Gordonia sp. KTR9 plasmid pGKT2, complete sequence) position: , mismatch: 5, identity: 0.839
gtggacggtgtcgttgccgcctt-gcccggag CRISPR spacer
gtcgacggtgtccttgccgccttcggccaga- Protospacer
** ********* ********** * **.**
25. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 5, identity: 0.839
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
aaccagcgtgtcgttgccaaggcccccggcc Protospacer
** ********************* **. *
26. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.839
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gatcagcgtgtcgttgccatcgccgccatac Protospacer
.* **************** ********.*
27. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.839
aagcagcgtgtcgttgccaaggccgcc-atgc CRISPR spacer
gaacagcgtgtcgttgccgacgccgccgatg- Protospacer
.*.***************.* ****** ***
28. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.839
aagcagcgtgtcgttgccaaggccgcc-atgc CRISPR spacer
gaacagcgtgtcgttgccgacgccgccgatg- Protospacer
.*.***************.* ****** ***
29. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.839
aagcagcgtgtcgttgccaaggccgcc-atgc CRISPR spacer
gaacagcgtgtcgttgccgacgccgccgatg- Protospacer
.*.***************.* ****** ***
30. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 5, identity: 0.839
aagcagcgtgtcgttgccaaggccgcc-atgc CRISPR spacer
gaacagcgtgtcgttgccgacgccgccgatg- Protospacer
.*.***************.* ****** ***
31. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 5, identity: 0.839
aagcagcgtgtcgttgccaaggccgcc-atgc CRISPR spacer
gaacagcgtgtcgttgccgacgccgccgatg- Protospacer
.*.***************.* ****** ***
32. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.839
aagcagcgtgtcgttgccaaggccgcc-atgc CRISPR spacer
gaacagcgtgtcgttgccgacgccgccgatg- Protospacer
.*.***************.* ****** ***
33. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 5, identity: 0.839
aagcagcgtgtcgttgccaaggccgcc-atgc CRISPR spacer
gaacagcgtgtcgttgccgacgccgccgatg- Protospacer
.*.***************.* ****** ***
34. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.839
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gttcagcaggtcgttgccgtcgccgccccac Protospacer
. ************.************* *
35. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.839
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gttcagcaggtcgttgccgtcgccgccccac Protospacer
. ************.************* *
36. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.839
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gttcagcaggtcgttgccgtcgccgccatcc Protospacer
. ************.************ **
37. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.839
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcaggtcgttgccgtcgccgccaacc Protospacer
..************.************ .**
38. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.839
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcaggtcgtcgccatcgccgccatcc Protospacer
..****************.******** **
39. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.839
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcaggtcgttgccgtcaccgccgtcc Protospacer
.*************.******.***** **
40. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.839
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcaggtcgttgccgtcaccgccgtcc Protospacer
.*************.******.***** **
41. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.839
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcaggtcgttgccgtcaccgccgtcc Protospacer
.*************.******.***** **
42. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
43. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
44. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013632 (Rhizobium sp. N324 plasmid pRspN324b, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
45. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
46. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
47. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
48. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
49. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
50. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
51. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
52. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
53. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
54. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
55. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
56. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
57. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
58. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
59. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
60. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
61. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
62. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.829
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcatcct- Protospacer
******* ** ************* ******. *.
63. spacer 2.25|2897500|34|NZ_LN832559|CRISPRCasFinder,CRT matches to MG592498 (Vibrio phage 1.123.O._10N.286.48.F3, partial genome) position: , mismatch: 6, identity: 0.824
cggccgtcttggcccccttctcgacaatcgcctc CRISPR spacer
cgaccgtcttggccaccttctcgacaatccgatg Protospacer
**.*********** ************** *
64. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 6, identity: 0.812
gtggcct---cacctcgcgcccgagcgcccgcaac CRISPR spacer
---gcctgaggacctcgcgcccgggcgcctgcaac Protospacer
**** ************.*****.*****
65. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 6, identity: 0.812
gtggcct---cacctcgcgcccgagcgcccgcaac CRISPR spacer
---gcctgaggacctcgcgcccgggcgcctgcaac Protospacer
**** ************.*****.*****
66. spacer 2.39|2898422|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tgccgagcgccgggcattcgacggtcgcatgcat- CRISPR spacer
tgccgagcgccgtggattcgacgg-ggcctgcaca Protospacer
************ * ********* ** ****.
67. spacer 2.41|2898554|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 6, identity: 0.824
ggcccggttcgcggcgatccgaaagccgcagccg- CRISPR spacer
ggcccggttcgcggcgatcgtaaag-agcaaccag Protospacer
******************* **** ***.**.
68. spacer 2.46|2898885|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 6, identity: 0.824
cggatgc-gcgcatggacgcccgcaacgagcgcgg CRISPR spacer
-ggctgcaaggcatggatgcccgcgacgagcgcgg Protospacer
** *** . *******.******.**********
69. spacer 2.60|2899815|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824
-accgcagctgcatccggtcgtattcgtcgaccgt CRISPR spacer
tatcgca-ctgcatccggtcgtatgcgttgacctc Protospacer
*.**** **************** ***.**** .
70. spacer 2.66|2900207|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_048046 (Caulobacter phage CcrPW, complete genome) position: , mismatch: 6, identity: 0.824
aatggatcacttggggcaagaaggacaatccgaa- CRISPR spacer
aatggatcacgtggggcgagaagga-aatgcgcgc Protospacer
********** ******.******* *** ** .
71. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007449 (Yersinia enterocolitica LC20 plasmid plasmid1_80K, complete sequence) position: , mismatch: 6, identity: 0.818
agaggacgcccgcgccgcgcttatc-tcgcaggt CRISPR spacer
cgaggacgccgccgccgcgcttatcgccgccgg- Protospacer
********* ************* .*** **
72. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.786
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
tgcggcgagatcgccggcggccggcagg Protospacer
. ******.********** ******
73. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 6, identity: 0.786
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
gccggcgaacccgccggcgcccggcaca Protospacer
.******* .***************.
74. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.786
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
gtcggcgaaatcgccggcgccgaggtcc Protospacer
******************** .* .*
75. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 6, identity: 0.786
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
tccggcgaaattgccggcggccggcggc Protospacer
..*********.******* *****. *
76. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggacaggtagtcgtcgccctcgccacccttc Protospacer
** *********************.**
77. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggacaggtagtcgtcgccctcgccacccttc Protospacer
** *********************.**
78. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_042342 (Pseudomonas virus H66, complete genome) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggtcaggtagttgtcgcccttgccgcggtgc Protospacer
***********.********.***** * .
79. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggtcaggtagtcgtcgcccccggcgcgcagg Protospacer
*******************.** *** *..
80. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagcasgtcgtcgccctcgccgccgnaa Protospacer
*. *** ******************* **
81. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggcgagggtgtcgtcgccctcgccgccgatc Protospacer
**. *** ********************
82. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_010502 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD06, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gctgaggtagtcgtcgcccttgccgcctgag Protospacer
* * ****************.****** .*.
83. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_010502 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD06, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gctgaggtagtcgtcgcccttgccgcctgag Protospacer
* * ****************.****** .*.
84. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggcgatgaagtcgtcgccctcgccgccaaac Protospacer
**. * * *******************.**
85. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gttgaggtagtcgtcgccgtcgtcgccgtag Protospacer
* * ************** ***.***** *.
86. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gttgaggtagtcgtcgccgtcgtcgccgtag Protospacer
* * ************** ***.***** *.
87. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gttgaggtagtcgtcgccgtcgtcgccgtag Protospacer
* * ************** ***.***** *.
88. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gttgaggtagtcgtcgccgtcgtcgccgtag Protospacer
* * ************** ***.***** *.
89. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gttgaggtagtcgtcgccgtcgtcgccgtag Protospacer
* * ************** ***.***** *.
90. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggggacgtagttgtagccctcgccgccgaac Protospacer
** * *****.** ***************
91. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP048425 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggcaaggtagtcatcgccgtcgccgccgtac Protospacer
**. ********.***** ********* *
92. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to MT188704 (Mesorhizobium phage Cp1R7A-A1, complete genome) position: , mismatch: 6, identity: 0.806
ggtcaggtagtcgtcgccctcgc-cgccgaaa CRISPR spacer
ggtcaggtcttcgtcgccctcgcgcagcgca- Protospacer
******** ************* *. ** *
93. spacer 4.2|3050314|31|NZ_LN832559|CRISPRCasFinder matches to NC_047992 (Microbacterium phage Zeta1847, complete genome) position: , mismatch: 6, identity: 0.806
gtggacggtgtcgttgccgccttgcccggag CRISPR spacer
gaggacggtgccgtcgccgccttgcggggcg Protospacer
* ********.***.********** ** *
94. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.806
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gatcagcgtgtcgctgcccaggccgccgtcc Protospacer
.* **********.**** ********.* *
95. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_010580 (Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence) position: , mismatch: 6, identity: 0.806
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
atccagcgtgtcgttgccgaggccgccgtcg Protospacer
* ***************.********.*
96. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.806
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gatcagcgtgtcgtcgccgaggccgccgagc Protospacer
.* ***********.***.********. **
97. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gaccagcgtgtcgttgcccagaccgccgagc Protospacer
.* *************** **.*****. **
98. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 6, identity: 0.806
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cagcagcgtgtcgttgccggggccgaccggc Protospacer
*****************..***** * **
99. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gaccagcgtgtcgttgccgatgccgccgagc Protospacer
.* ***************.* ******. **
100. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP019319 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence) position: , mismatch: 6, identity: 0.806
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
atccagcgtgtcgttgccgacgccgccgcgc Protospacer
* ***************.* ******..**
101. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP016500 (Agrobacterium sp. RAC06 plasmid pBSY240_1, complete sequence) position: , mismatch: 6, identity: 0.806
aagcagcgtgtcgttgccaaggc-cgccatgc CRISPR spacer
aaacagcatgtcgttgccaaggctcgacaaa- Protospacer
**.****.*************** ** ** .
102. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP045856 (Agrobacterium sp. MA01 plasmid punanmed2, complete sequence) position: , mismatch: 6, identity: 0.806
aagcagcgtgtcgttgccaaggc-cgccatgc CRISPR spacer
aaacagcatgtcgttgccaaggctcgacaaa- Protospacer
**.****.*************** ** ** .
103. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.806
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
atggagcgtgtcgtcgcctaggccgcccttc Protospacer
* * **********.*** ******** * *
104. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP048425 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
catcagcaggtcgtcgccgtcgccgccatag Protospacer
.*************************
105. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagcaggtcgtcaccgtcgccgcccgat Protospacer
. .************.************* .
106. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagccggtcgtcgccgtcgccgccctgc Protospacer
. .**** ******************** *
107. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcaccagatcgtcgccgtcgccggctgtc Protospacer
.**** ***.*************** *.*.*
108. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagcaggtcgtcgccgtcgccgccatgc Protospacer
. .************************ *
109. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcgtgtcgtcgccgtcgccgccgtcc Protospacer
..*****. ****************** **
110. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022543 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-3, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcaggtcgtcgccatcgccgcctagc Protospacer
..****************.********.. *
111. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcaggtcgttgccgacgccgccgtcg Protospacer
.*************.**** ******* *
112. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcaggtcgttgccgacgccgccgtcg Protospacer
.*************.**** ******* *
113. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcaggtcgttgccgacgccgccgtcg Protospacer
.*************.**** ******* *
114. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcaggtcgtcgccatcgccaccatcc Protospacer
..****************.*****.** **
115. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to MN908693 (Gordonia phage AnClar, complete genome) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtgagcacgtcgtcgccgtcgccgccctgg Protospacer
.** **** *******************
116. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to MK801725 (Gordonia phage Yago84, complete genome) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtgagcacgtcgtcgccgtcgccgccctgg Protospacer
.** **** *******************
117. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcaggtcgttgccgtcaccgccgtcc Protospacer
..************.******.***** **
118. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcaggtcgttgccgtcaccgccgtcc Protospacer
..************.******.***** **
119. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcaggtcgttgccgtcaccgccgtcc Protospacer
..************.******.***** **
120. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atccatcaggtcgtcgccgtcgccgccgtgc Protospacer
* .** ********************* *
121. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcacgtcgtcgccgttgccgccggac Protospacer
..****** ***********.****** * *
122. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015234 (Epibacterium mobile F1926 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcacgtcgtcgccatcgccgccgatc Protospacer
.******* *********.******** ..*
123. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015234 (Epibacterium mobile F1926 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcacgtcgtcgccatcgccgccgatc Protospacer
.******* *********.******** ..*
124. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
catcagcaggtcgtcgccgtcgtcacccatc Protospacer
.********************.*.***..*
125. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
aaccagcgtgtcgtcgccgtcgccgccggac Protospacer
*..****. ****************** * *
126. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcacgtcgtcgccgttgccgccggac Protospacer
..****** ***********.****** * *
127. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcacgtcgtcgccgttgccgccggac Protospacer
..****** ***********.****** * *
128. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
attcagcaggtcgttgccggcgccgccggtg Protospacer
* ************.**** ******* *.
129. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
attcagcaggtcgttgccggcgccgccggtg Protospacer
* ************.**** ******* *.
130. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatgaacaggtcgtcgccatcgccgcccgac Protospacer
..* *.************.********** *
131. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatgaacaggtcgtcgccatcgccgcccgac Protospacer
..* *.************.********** *
132. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP041042 (Paracoccus sp. AK26 plasmid pAK4, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
catcatcaggtcgtcgccgttgccgccgtcc Protospacer
.*** **************.****** **
133. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP020447 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
acgcagcaggtcgttgccggcgccgccgtcc Protospacer
* ***********.**** ******* **
134. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atgcagcaggtcgttgccggcgccgcctccc Protospacer
* ***********.**** *******. **
135. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_014159 (Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence) position: , mismatch: 6, identity: 0.806
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
agcgcggaggtcgtcgccgtcgaggcccgcc Protospacer
**. * *************** *******
136. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 7, identity: 0.8
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcagcatcct- Protospacer
******* ** ************* **.***. *.
137. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 7, identity: 0.8
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcgtcct- Protospacer
******* ** ************* *****.. *.
138. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.8
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcgtcct- Protospacer
******* ** ************* *****.. *.
139. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 7, identity: 0.8
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcggcgtcct- Protospacer
******* ** ************* *****.. *.
140. spacer 2.14|2896772|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.788
tccatgggtcgcagcttcatccgggccgcgctg CRISPR spacer
acgatcggttgcagcttcatccgggcccagcgg Protospacer
* ** ***.***************** ** *
141. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.794
gccgctgcggcgcgagcgcatcgaattcgtcgat CRISPR spacer
ctcggctcggcgcgagcgcatcgacttcgtcgag Protospacer
.** . ***************** ********
142. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 7, identity: 0.794
gccgctgcggcgcgagcgcatcga--attcgtcgat CRISPR spacer
gccgctgcggggcgagcacatcgatcatcctccg-- Protospacer
********** ******.****** **.* .**
143. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
gtggcctcacctggcgcccgaccgacatgacc Protospacer
************ ******** ** * * *
144. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
gtggcctcacctggcgcccgaccgacatgacc Protospacer
************ ******** ** * * *
145. spacer 2.38|2898356|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MF417960 (Uncultured Caudovirales phage clone 9F_4, partial genome) position: , mismatch: 7, identity: 0.794
cagcgcacagccttcggcggcaaggtttcgggcc CRISPR spacer
caacaccatgcctttggcggcaaggtttcaggcc Protospacer
**.*.* *****.**************.****
146. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MT024866 (Mycobacterium phage Willsammy, complete genome) position: , mismatch: 7, identity: 0.788
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaggg Protospacer
. * .******* ******** **********
147. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN234172 (Mycobacterium phage ThulaThula, complete genome) position: , mismatch: 7, identity: 0.788
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
ctacaacgcccgcgccgcgctcgtctcgcaggg Protospacer
* .****************..*********
148. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to KR080195 (Mycobacterium phage Phayonce, complete genome) position: , mismatch: 7, identity: 0.788
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
ttacaacgcccgcgccgcgctcgtctcgcaggg Protospacer
* .****************..*********
149. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN585977 (Mycobacterium phage Atcoo, complete genome) position: , mismatch: 7, identity: 0.788
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaggg Protospacer
. * .******* ******** **********
150. spacer 2.80|2901134|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 7, identity: 0.788
gaccacctcggcccggtgcggcgcatctggggc CRISPR spacer
gaccacatcggcccggcgcggcgctcccccggc Protospacer
****** *********.******* .*. ***
151. spacer 2.80|2901134|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020702 (Streptomyces tsukubensis strain NRRL 18488 plasmid pSTS2, complete sequence) position: , mismatch: 7, identity: 0.788
gaccacctcggcccggtgcggcgcatctggggc CRISPR spacer
gaccacatcggcccggcgcggcgctcccccggc Protospacer
****** *********.******* .*. ***
152. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.75
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
tattccgaaatcctcggcgcccggcatc Protospacer
. . ******* .**************
153. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 7, identity: 0.75
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
gtcggcgaattcgtcggcgcccggttcg Protospacer
******** ***.**********. .
154. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 7, identity: 0.75
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
gtcggcgaattcgtcggcgcccggttcg Protospacer
******** ***.**********. .
155. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.75
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
ttcggcgaaagcgccagcgcccgggcga Protospacer
.********* ****.********
156. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.75
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
ttcggcgaaagcgccagcgcccgggcga Protospacer
.********* ****.********
157. spacer 3.1|3050068|28|NZ_LN832559|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 7, identity: 0.75
ctcggcgaaatcgccggcgcccggcatc CRISPR spacer
gtcggcgaattcgtcggcgcccggttcg Protospacer
******** ***.**********. .
158. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgcccatc Protospacer
*. *** .******************* *
159. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgcccatc Protospacer
*. *** .******************* *
160. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgcccatc Protospacer
*. *** .******************* *
161. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgcccatc Protospacer
*. *** .******************* *
162. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgcccatc Protospacer
*. *** .******************* *
163. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgcccatc Protospacer
*. *** .******************* *
164. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgcccatc Protospacer
*. *** .******************* *
165. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgcccatc Protospacer
*. *** .******************* *
166. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgccgtgc Protospacer
*. *** .******************** .
167. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgccgtgc Protospacer
*. *** .******************** .
168. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgccgtgc Protospacer
*. *** .******************** .
169. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgccgtgc Protospacer
*. *** .******************** .
170. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgccgtgc Protospacer
*. *** .******************** .
171. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gnacagccagtcgtcgccctcgccgccgtgc Protospacer
* *** .******************** .
172. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgccgtgc Protospacer
*. *** .******************** .
173. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gtccaggtagtcgtcgccttcgtcgccgtgc Protospacer
* .***************.***.***** .
174. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gcccaggtagtagtcgccctggccgccgcct Protospacer
* .******** ******** *******
175. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gcccaggtagtagtcgccctggccgccgcct Protospacer
* .******** ******** *******
176. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaagaggaaatcgtcgccctcgccgccgatc Protospacer
*. *** *.*******************
177. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacaggcggtcgtcgccctcgccgccgcgg Protospacer
*. ****..******************* ..
178. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
cggcacatagttgtagccctcgccgccgaac Protospacer
* ** .****.** ***************
179. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacaggcggtcgtcgccctcgccgccgcgg Protospacer
*. ****..******************* ..
180. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_010502 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD06, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gctgaggtagtcgtcgcccttgccaccggtg Protospacer
* * ****************.***.***. .
181. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_010502 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD06, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gctgaggtagtcgtcgcccttgccaccggtg Protospacer
* * ****************.***.***. .
182. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_010502 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD06, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gctgagatagtcgtcgcccttgccgccggtg Protospacer
* * **.*************.*******. .
183. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggctccgtcgtcgtcgacctcgccgccgaac Protospacer
**.. ** ******* *************
184. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgcccatc Protospacer
*. *** .******************* *
185. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP035420 (Leisingera sp. NJS204 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaagatgtggtcgtcgcccttgccgccgaag Protospacer
*. * **.***********.*********.
186. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP038235 (Leisingera sp. NJS201 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaagatgtggtcgtcgcccttgccgccgaag Protospacer
*. * **.***********.*********.
187. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaacagccagtcgtcgccctcgccgcccatc Protospacer
*. *** .******************* *
188. spacer 4.2|3050314|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.774
gtggacggtgtcgttgccgccttgcccggag CRISPR spacer
gcgcgcggtgtcgttgccgcctcgaccggca Protospacer
*.* .*****************.* **** .
189. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gcgcaacgtgtcgttgccaaggccgccgaca Protospacer
. ***.*********************.
190. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
ccagagcgtgtcgctgccaaggccgccatcg Protospacer
. *********.***************
191. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtggccaaggccgccgtcg Protospacer
*********** ************.*
192. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gcgcagcgtgtcgttgccactgccgccggtc Protospacer
. ***************** ******. *
193. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
caccagcgtgtcgttgccgagaccgccgccc Protospacer
* ***************.**.*****.. *
194. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gcggaaggtgtcgttgccaagaccgccatcc Protospacer
. * *. **************.******* *
195. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
atccagcgtgtcgttgccattgccgccgtcg Protospacer
* **************** ******.*
196. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gtacagcgtgtcgttgccgtggccgccttcc Protospacer
. .***************. ******* * *
197. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gaccagggtgtcgttgcccaggccgccttca Protospacer
.* *** *********** ******** *
198. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gtccagcgtgtcgttgccccggccgcccagc Protospacer
. *************** ******* **
199. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP025584 (Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gatcagcgtgtcgttgccattgccgccgatc Protospacer
.* **************** ******. *
200. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gcggaaggtgtcgttgccaagaccgccatcc Protospacer
. * *. **************.******* *
201. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gaccagcgtgtcgtcgccaagcccgccgatc Protospacer
.* ***********.****** *****. *
202. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gaccagcgtgtcgtcgccaagcccgccgatc Protospacer
.* ***********.****** *****. *
203. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gaccagcgtgtcgtcgcccaggccgccgatc Protospacer
.* ***********.*** ********. *
204. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
atagagcgtgtcgttgccgagcccgccgtcc Protospacer
* . **************.** *****.* *
205. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagc-gtgtcgttgccaaggccgccatgc CRISPR spacer
-gacggcggtgtcgttgcccaggcctccatgg Protospacer
..*.** *********** ***** *****
206. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 7, identity: 0.774
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
atagagcgtgtcgttgccgacgccgccgtcc Protospacer
* . **************.* ******.* *
207. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggacagcaggtcggccccgtcgccgccgctc Protospacer
.* ********** * *********** .*
208. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ttccagaaggtcgtcgccggcgccgccggac Protospacer
.*** ************ ******* * *
209. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctccagcgtgtcgtcgccgtcgccgccggac Protospacer
.****. ****************** * *
210. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggccagcgtgtcgtcgccgtcgccgccgtcg Protospacer
.*.****. ****************** *
211. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctccagcaggtcgttgccgtccccgccatcc Protospacer
.***********.****** ***** **
212. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggacagcaggtcggccccgtcgccgccgctc Protospacer
.* ********** * *********** .*
213. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctccagcgtgtcgtcgccgtcgccgccggac Protospacer
.****. ****************** * *
214. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ttccagaaggtcgtcgccggcgccgccggac Protospacer
.*** ************ ******* * *
215. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggacagcaggtcggccccgtcgccgccgctc Protospacer
.* ********** * *********** .*
216. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
aatcagccggtagtcgccgtcgccgagatcc Protospacer
*.***** *** ************* **
217. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtgcagaaggtcgtcgccgtcgccaccgtcc Protospacer
. *** *****************.** **
218. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
aatcagccggtagtcgccgtcgccgagatcc Protospacer
*.***** *** ************* **
219. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ttcaagcaggtcgtcgccttcgccgcccagc Protospacer
. ************** *********. *
220. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtacagcaggtcgtcgccggcgccgccgacg Protospacer
. **************** ******* .*
221. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ccggagcaggtcgacgccgccgccgcccgcg Protospacer
********* *****.**********
222. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ttcaagcaggtcgtcgccttcgccgcccagc Protospacer
. ************** *********. *
223. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgtcgccggcgccgccatcg Protospacer
. **************** ******* *
224. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ttcaagcaggtcgtcgccttcgccgcccagc Protospacer
. ************** *********. *
225. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gctcagcaggtcgtcgccgttcccgccgaac Protospacer
. ******************. ***** . *
226. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctctcgcaggtcgtcgccctcggcgcccgcc Protospacer
.. ************* *** ********
227. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgtcgccgccgctc Protospacer
. ***********.************ .*
228. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgtcgccgccgctc Protospacer
. ***********.************ .*
229. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgtcgccgccgctc Protospacer
. ***********.************ .*
230. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgtcgccgccgctc Protospacer
. ***********.************ .*
231. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
catcagcaggtcgtcaccgtcgccagcctgc Protospacer
.*************.********. ** *
232. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgtcgccgccgctc Protospacer
. ***********.************ .*
233. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgtcgccgccgctc Protospacer
. ***********.************ .*
234. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgtcgccgccgctc Protospacer
. ***********.************ .*
235. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP019319 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggccagcacgtcgtcgccgttgccgccgatc Protospacer
.*.***** ***********.****** ..*
236. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ttcaagcaggtcgtcgccttcgccgcccagc Protospacer
. ************** *********. *
237. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaccagcgtgtcgtcgccgtcgccgccggac Protospacer
...****. ****************** * *
238. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
cagcagcgtgtcgtcgccgtcgccgccgtcc Protospacer
. ****. ****************** **
239. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcatgtcgtcgccgtcgccgccgatc Protospacer
.. ***** ****************** ..*
240. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gctcagcaggtcgtcgccgttcccgccgaac Protospacer
. ******************. ***** . *
241. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gctcagcaggtcgtcgccgttcccgccgaac Protospacer
. ******************. ***** . *
242. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atccatcaggtcgtcgccgtcgcccccatgc Protospacer
* .** ****************** ** *
243. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gttcatcaggtcgtcgccgtcgccaccgtgc Protospacer
. *** ******************.** *
244. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagcaggtcgtcgccctctccgccgatc Protospacer
..**************** ** ***** ..*
245. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctccagctggtcggcgccgtcgccgcccagc Protospacer
.**** ***** **************. *
246. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctccagctggtcggcgccgtcgccgcccagc Protospacer
.**** ***** **************. *
247. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctcgaccaggtcgccgccgtcgtcgcccgcc Protospacer
. * *******.********.********
248. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP031958 (Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagctggtcgtcgccgtcgccacctttc Protospacer
..***** ****************.**. .*
249. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctccagcgtgtcgtcgccgtcgccgcccatc Protospacer
.****. *******************..*
250. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagcgtgtcgtcgccgtcgccgccggac Protospacer
. .****. ****************** * *
251. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctccagctggtcggcgccgtcgccgcccagc Protospacer
.**** ***** **************. *
252. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctccagctggtcggcgccgtcgccgcccagc Protospacer
.**** ***** **************. *
253. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
acgcagcaggtcgtccccggcgccgccgaac Protospacer
* ************ *** ******* . *
254. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atccaggatgtcgtcgccgtcgccgccgatc Protospacer
* .*** * ****************** ..*
255. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagcaggtcgtccccatcgccgccgtcc Protospacer
. .************ **.******** **
256. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcatatcgtcgccgtcgccgccggac Protospacer
.. ***** .***************** * *
257. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP040760 (Paracoccus sp. 2251 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atccagcaggtcgttgccggcgccgccgttc Protospacer
* .***********.**** ******* .*
258. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
acgccgccggtcgtcgccgtcgccgcctgga Protospacer
* * ** *******************.*
259. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atccatcaggtcgtcgccgtcgcccccgtgc Protospacer
* .** ****************** ** *
260. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcacgtcgttgccgtcgccgccggac Protospacer
.. ***** *****.************ * *
261. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
acgccgccggtcgtcgccgtcgccgcctgga Protospacer
* * ** *******************.*
262. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to MK686071 (Streptomyces phage Mischief19, complete genome) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagctcgtcgtcgccgtcgccggtctcg Protospacer
.****** **************** .* *
263. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
acgccgccggtcgtcgccgtcgccgcctgga Protospacer
* * ** *******************.*
264. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atccatcaggtcgtcgccgtcgcccccgtgc Protospacer
* .** ****************** ** *
265. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_048115 (Arthrobacter phage Liebe, complete genome) position: , mismatch: 7, identity: 0.774
agtcag-caggtcgtcgccgtcgccgcccgcc CRISPR spacer
-gtaggccaggacgtcgccgtcgccgtccggg Protospacer
** .* **** **************.***
266. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcttcaggtcgtcgccgtcgacggccgtc Protospacer
..** **************** ** ***.*
267. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.774
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
aaccaccacgtcgtcgccgtcgccgcacatc Protospacer
*..** ** ***************** *..*
268. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 8, identity: 0.771
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcagcgtcct- Protospacer
******* ** ************* **.**.. *.
269. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 8, identity: 0.771
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcagcgtcct- Protospacer
******* ** ************* **.**.. *.
270. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 8, identity: 0.771
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcagcgtcct- Protospacer
******* ** ************* **.**.. *.
271. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 8, identity: 0.771
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcagcgtcct- Protospacer
******* ** ************* **.**.. *.
272. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 8, identity: 0.771
cttccagcagcacatcgggcggga-tcggcacgccg CRISPR spacer
cttccagaagaacatcgggcgggattcagcgtcct- Protospacer
******* ** ************* **.**.. *.
273. spacer 2.19|2897104|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_012854 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence) position: , mismatch: 8, identity: 0.765
cccaggtggcgcgctggatctgcaccggaccgtc CRISPR spacer
tcggtatcgcgcgcttgatctgcaccggcccgtc Protospacer
.* . .* ******* ************ *****
274. spacer 2.19|2897104|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018232 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765
cccaggtggcgcgctggatctgcaccggaccgtc CRISPR spacer
tcggtatcgcgcgcttgatctgcaccggcccgtc Protospacer
.* . .* ******* ************ *****
275. spacer 2.19|2897104|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016291 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.765
cccaggtggcgcgctggatctgcaccggaccgtc CRISPR spacer
tcggtatcgcgcgcttgatctgcaccggcccgtc Protospacer
.* . .* ******* ************ *****
276. spacer 2.19|2897104|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
---cccaggtggcgcgctggatctgcaccggaccgtc CRISPR spacer
acacccg---ggcgcgctggatctgcgccggatcgcg Protospacer
***. ****************.*****.**.
277. spacer 2.21|2897235|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ctgccgccatcctgcagggcatccacgcccgcgc CRISPR spacer
ccggcagcgacctgcagggcatcaaggcccgcgc Protospacer
*.* *. *. ************* * ********
278. spacer 2.21|2897235|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022192 (Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765
ctgccgccatcctgcagggcatccacgcccgcgc- CRISPR spacer
tgcccgccatcctgctgggcatccccg-gcacgcc Protospacer
. ************ ******** ** *.***
279. spacer 2.21|2897235|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.765
ctgccgccatcctgcagggcatccacgcccgcgc- CRISPR spacer
agtacgcgatcctgcagggcatctacg-cggcgcc Protospacer
*** ***************.*** * ****
280. spacer 2.28|2897700|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.771
gggtaagg----ggtggtgaccagcgccgcgaaattgtc CRISPR spacer
----actgcttcggtggcgaccagcgccgcgaaactgtc Protospacer
* * *****.****************.****
281. spacer 2.29|2897767|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 8, identity: 0.758
acgccatcctcgccgaaatggaggcgctgaaat CRISPR spacer
ccaccgtccgcgccgaaatggaggcgcagccgt Protospacer
*.**.*** ***************** * .*
282. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.765
gccgctgcggcgcgagcgcatcgaattcgtcgat CRISPR spacer
cgcgcgcgcgcgccagcgcatcgaattcgtcgaa Protospacer
*** **** *******************
283. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.765
gccgctgcggcgcgagcgcatcgaattcgtcgat--- CRISPR spacer
gccgctgccgcgcgcgcgcatcgag---agcgatctg Protospacer
******** ***** *********. . ****
284. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.765
gccgctgcggcgcgagcgcatcgaattcgtcgat--- CRISPR spacer
gccgctgccgcgcgcgcgcatcgag---agcgatctg Protospacer
******** ***** *********. . ****
285. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
gccgctgcggcgcgagcgcatcgaattcgtcgat CRISPR spacer
gccgctgctgcgcgagcgcttcgatctggtggtg Protospacer
******** ********** **** .* ** *
286. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagcgcccgcacc Protospacer
.. * ************ ********** *
287. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagcgcccgcacc Protospacer
.. * ************ ********** *
288. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagcgcccgcacc Protospacer
.. * ************ ********** *
289. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagcgcccgcacc Protospacer
.. * ************ ********** *
290. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 8, identity: 0.75
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
gtggccttacctcgcgcccgcgccgcctttgc Protospacer
*******.************ ** ** . .*
291. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagcgcccgcacc Protospacer
.. * ************ ********** *
292. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagcgcccgcacc Protospacer
.. * ************ ********** *
293. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagcgcccgcacc Protospacer
.. * ************ ********** *
294. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagcgcccgcacc Protospacer
.. * ************ ********** *
295. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 8, identity: 0.75
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
gtggccttacctcgcgcccgcgccgcctttgc Protospacer
*******.************ ** ** . .*
296. spacer 2.41|2898554|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_048098 (Arthrobacter phage Andrew, complete genome) position: , mismatch: 8, identity: 0.765
ggcccggt-tcgcggcgatccgaaagccgcagccg CRISPR spacer
-gtctgctgctgcggcgatccggaagccgcggccg Protospacer
*.*.* * ..***********.*******.****
297. spacer 2.44|2898752|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
tagacagcgcggtcgcgccaagcaggac-accgct CRISPR spacer
ccgacagcgcgctcgcgccgagcagggcgagtgc- Protospacer
. ********* *******.******.* * .**
298. spacer 2.45|2898818|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046475 (Janibacter melonis strain M714 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771
gtcaggccagccccgccgcccatgacggcgaggct CRISPR spacer
gctacaccagccccgccggccaggacggcgagccg Protospacer
*..* .************ *** ********* *
299. spacer 2.61|2899881|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
gaccgggctgcacaaccacgaccagcgacggca CRISPR spacer
gcccgtgctgcacaaccacgacccgctgcccga Protospacer
* *** ***************** ** .* *
300. spacer 2.61|2899881|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758
gaccgggctgcacaaccacgaccagcgacggca CRISPR spacer
ctccgggctgcgcaaccccgaccagcttcgccc Protospacer
*********.***** ******** ** *
301. spacer 2.63|2900011|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 8, identity: 0.75
cggttgcgatggtgatgttgctttcgcacgtt CRISPR spacer
gagcgacgatggtgatggcgctttcgcacgtg Protospacer
.*. .*********** .************
302. spacer 2.63|2900011|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 8, identity: 0.75
cggttgcgatggtgatgttgctttcgcacgtt CRISPR spacer
gagcgacgatggtgatggcgctttcgcacgtg Protospacer
.*. .*********** .************
303. spacer 2.67|2900273|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016722 (Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11C, complete sequence) position: , mismatch: 8, identity: 0.765
gccgtacgtcgagtacttccacatcat---gtttgag CRISPR spacer
ctggtacgtcgagtacttcaacatcatccagttc--- Protospacer
. **************** ******* ***.
304. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MF373843 (Mycobacterium phage StevieRay, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
305. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MK016499 (Mycobacterium phage Mangethe, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcgcgcgccgcgctgatctcgcaagg Protospacer
. * .**** *********** ********.*
306. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MK919480 (Mycobacterium phage Techage, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcgcgcgccgcgctgatctcgcaagg Protospacer
. * .**** *********** ********.*
307. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN892486 (Mycobacterium phage KilKor, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
308. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MK814758 (Mycobacterium phage FirstPlacePfu, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
309. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MK494122 (Mycobacterium phage GreaseLightnin, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
310. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN010757 (Mycobacterium phage HUHilltop, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
311. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN908683 (Mycobacterium phage StressBall, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
312. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MK524508 (Mycobacterium phage Zilizebeth, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
313. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN096356 (Mycobacterium phage Bunnies, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
314. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MK820639 (Mycobacterium phage Phineas, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
315. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN892484 (Mycobacterium phage CactusJack, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
316. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MT498061 (Mycobacterium phage Jung, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
317. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MF133446 (Mycobacterium phage Bogie, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
318. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to KT347313 (Mycobacterium phage Brusacoram, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
319. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MF919492 (Mycobacterium phage Arib1, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcgcgcgccgcgctgatctcgcaagg Protospacer
. * .**** *********** ********.*
320. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MF140399 (Mycobacterium phage Bartholomew, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
321. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MH230879 (Mycobacterium phage Xavia, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcgcgcgccgcgctgatctcgcaagg Protospacer
. * .**** *********** ********.*
322. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN807249 (Mycobacterium phage Megiddo, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
323. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MK937604 (Mycobacterium phage Necropolis, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
324. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_041969 (Mycobacterium phage Jebeks, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
325. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_026605 (Mycobacterium phage Malithi, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
326. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_023552 (Mycobacterium phage Donovan, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
327. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to KC691256 (Mycobacterium phage Fishburne, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
328. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN807250 (Mycobacterium phage Glaske, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
329. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MF472894 (Mycobacterium phage Majeke, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcgcgcgccgcgctgatctcgcaagg Protospacer
. * .**** *********** ********.*
330. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MF281061 (Mycobacterium phage Ksquared, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
331. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to KU985090 (Mycobacterium phage Shipwreck, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
332. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MG198785 (Mycobacterium phage Thespis, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
333. spacer 2.79|2901069|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN807248 (Mycobacterium phage Phalm, complete genome) position: , mismatch: 8, identity: 0.758
agaggacgcccgcgccgcgcttatctcgcaggt CRISPR spacer
gtacaacgcccgggccgcgctgatctcgcaagg Protospacer
. * .******* ******** ********.*
334. spacer 2.80|2901134|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
-gaccacctcggcccggtgcggcgcatctggggc CRISPR spacer
tggtcgatcc-gcccggtgcggcgcatctggtgc Protospacer
*..*. ..* ******************** **
335. spacer 2.80|2901134|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 8, identity: 0.758
-gaccacctcggcccggtgcggcgcatctggggc CRISPR spacer
tggtcgatcc-gcccggtgcggcgcatctggtgc Protospacer
*..*. ..* ******************** **
336. spacer 2.80|2901134|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN657133 (Cryobacterium sp. strain ANT_H10B plasmid pA10BH1, complete sequence) position: , mismatch: 8, identity: 0.758
gaccacctcggcccggtgcggcgcatctggggc CRISPR spacer
gtgcccgccggcccggtgcggcgctcctggggg Protospacer
* * * .**************** .******
337. spacer 2.80|2901134|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758
gaccacctcggcccggtgcggcgcatctggggc CRISPR spacer
ctcgagctcggcccgctgcggcgcgtctggcgt Protospacer
* * ********* ********.***** *.
338. spacer 2.81|2901199|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.758
ggacatcgacggctcctacaacctgacctggcc CRISPR spacer
caccatcgacggctccttcgacctgaccaagtc Protospacer
. ************** *.******** .*.*
339. spacer 2.81|2901199|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 8, identity: 0.758
ggacatcgacggctcctacaacctgacctggcc CRISPR spacer
caccatcgacggctccttcgacctgaccaagtc Protospacer
. ************** *.******** .*.*
340. spacer 2.84|2901396|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019438 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.771
ttcatgctggcgacattcgcggcgtgtttcgcctc CRISPR spacer
ctgctgggcgcgaccttcgcggcgtggttcgcctc Protospacer
.* ** ***** *********** ********
341. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.742
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
aatcaggtagtcgttgccttcgccgccatcc Protospacer
..************.***.********.
342. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.742
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggcgcagtagttctcgccctcgccgccgagc Protospacer
**. .*****. ****************.
343. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 8, identity: 0.742
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
atccatgaagtcgtcgccctcgccgccatag Protospacer
. .** * *******************. *.
344. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_009956 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI02, complete sequence) position: , mismatch: 8, identity: 0.742
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
atttaggtagtcgtcgccgtcgccgccttcg Protospacer
. *.************** ******** .
345. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
caacaggtagtcgtcgcgcccgccgccggtg Protospacer
. ************** *.********. .
346. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 8, identity: 0.742
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gaggatcgagtcgttgccctcgccgccggaa Protospacer
*. * ******.*************.**
347. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.742
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ggcgcagtagttctcgccctcgccgccgagc Protospacer
**. .*****. ****************.
348. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 8, identity: 0.742
--ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ccgacc--gtggtcgtcgccctcggcgccgacg Protospacer
*..* **.************* ****** .
349. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 8, identity: 0.742
--ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ccgacc--gtggtcgtcgccctcggcgccgacg Protospacer
*..* **.************* ****** .
350. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.742
--ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ccgacc--gtggtcgtcgccctcggcgccgacg Protospacer
*..* **.************* ****** .
351. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 8, identity: 0.742
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
catgagatagtcgtcgcccgcgccgcccgag Protospacer
.* **.************ ******* .*.
352. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 8, identity: 0.742
--ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ccgacc--gtggtcgtcgccctcggcgccgacg Protospacer
*..* **.************* ****** .
353. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gagcagcgtatcgttgccaaggccggtcgaa Protospacer
.********.*************** . .
354. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP049248 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gttaagcgtgtcgttgccagcgccgccatca Protospacer
. ***************. ********
355. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gtccagcgtgtcgttgccgatgccgccgatc Protospacer
. ***************.* ******. *
356. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gagcagcgtgtcggtgccgaggccgaacttg Protospacer
.************ ****.****** *
357. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gttcagcgtgtcgttgcccatgccgccgtcg Protospacer
. *************** * ******.*
358. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgtccaaggccgccgtcg Protospacer
*********** ***********.*
359. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgtccaaggccgccgtcg Protospacer
*********** ***********.*
360. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgtccaaggccgccgtcg Protospacer
*********** ***********.*
361. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcatggccaaggccgccgtcg Protospacer
*********.* ************.*
362. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcatggccaaggccgccgtcg Protospacer
*********.* ************.*
363. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgcccaaggccgccgtcg Protospacer
*********** ***********.*
364. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgcccaaggccgccgtcg Protospacer
*********** ***********.*
365. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgcccaaggccgccgtcg Protospacer
*********** ***********.*
366. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgtccaaggccgccgtcg Protospacer
*********** ***********.*
367. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to MN694006 (Marine virus AFVG_250M23, complete genome) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gtccagcgagtcgttgccaaggccgtcgagg Protospacer
. ***** ****************.*. *
368. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015745 (Shinella sp. HZN7 plasmid pShin-09, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
taccagcgtggccttgccaaggccgccgacg Protospacer
* ******* * **************.
369. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgcccaaggccgccgtcg Protospacer
*********** ***********.*
370. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgcccaaggccgccgtcg Protospacer
*********** ***********.*
371. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgtccaaggccgccgtcg Protospacer
*********** ***********.*
372. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgtccaaggccgccgtcg Protospacer
*********** ***********.*
373. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgtccaaggccgccgtcg Protospacer
*********** ***********.*
374. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcatggccaaggccgccgtcg Protospacer
*********.* ************.*
375. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgcccaaggccgccgtcg Protospacer
*********** ***********.*
376. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgtccaaggccgccgtcg Protospacer
*********** ***********.*
377. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgtccaaggccgccgtcg Protospacer
*********** ***********.*
378. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcgtgtccaaggccgccgtcg Protospacer
*********** ***********.*
379. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
cttcagcgtgtcatggccaaggccgccgtcg Protospacer
*********.* ************.*
380. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
ggacagcgtgtcgttgccgacgccgccggtc Protospacer
...***************.* ******. *
381. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to KP162168 (Paracoccus phage vB_PmaS-R3, complete genome) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
tcgcagcgtatcgttgccatggccgggaacc Protospacer
*******.********* ***** * *
382. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_026608 (Paracoccus phage vB_PmaS_IMEP1, complete genome) position: , mismatch: 8, identity: 0.742
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
tcgcagcgtatcgttgccatggccgggaacc Protospacer
*******.********* ***** * *
383. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcacatcgtcgccgtcgccgctgctg Protospacer
.******* .****************. .
384. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
acgcagcaggtcgttgccgccgccgccgctg Protospacer
* ***********.****.******* .
385. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gctgagcaggtcgttgccgttgccgccgccg Protospacer
. * **********.*****.****** *
386. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ttccagccggtcgtcgccgtcgtcgccgaac Protospacer
.**** **************.**** . *
387. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcagggcgtcgccgtcgccgacattc Protospacer
.. ******* ************** * .*
388. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctccagctggtcgtcgccggcgccgccgatc Protospacer
.**** *********** ******* ..*
389. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
acgcagcaggtcgttgccgccgccgccgctg Protospacer
* ***********.****.******* .
390. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gctgagcaggtcgttgccgttgccgccgccg Protospacer
. * **********.*****.****** *
391. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gctgagcaggtcgttgccgttgccgccgccg Protospacer
. * **********.*****.****** *
392. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagccggtagtcgccgtcgccgagatcc Protospacer
..***** *** ************* **
393. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacaacaggtcgtcgccctcgccgccgaac Protospacer
.. **.************ ******** . *
394. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagccggtagtcgccgtcgccgagatcc Protospacer
..***** *** ************* **
395. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcagccggtagtcgccgtcgccgagatcc Protospacer
..***** *** ************* **
396. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
catcagcaggtcatcgccgtcaccgccatag Protospacer
.**********.********.*****
397. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gagcagctggtcgtcgccgtcgccgccattg Protospacer
.. **** ******************* .
398. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gagcagctggtcgtcgccgtcgccgccattg Protospacer
.. **** ******************* .
399. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgtcgccgccgctg Protospacer
. ***********.************ .
400. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagcgtgtcgtcgccgtcgccgccgttc Protospacer
. .****. ****************** .*
401. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtgctggagggcgtcgccttcgccgcccgcg Protospacer
. * * *** ******* ***********
402. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ccgagacaggtcggcgccgtcggcgcccgcc Protospacer
..******* ******** ********
403. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggccagctggtcgtcgccatcgccgccgatg Protospacer
.*.**** **********.******** ..
404. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atgcatcaggtcgtcgccgtcgtcgccatag Protospacer
* ** ****************.****
405. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to MT684587 (Microbacterium phage Fede, complete genome) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctgaagcaggtcgtcgccctcgccgcctaca Protospacer
************** ********..*
406. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gctgagcaggtcgttgccgttgccgccgccg Protospacer
. * **********.*****.****** *
407. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
cttcagcaggtcgttgccatcgccgccatag Protospacer
************.***.********
408. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctccagctggtcggcgccgtcgccgccaagc Protospacer
.**** ***** ************* . *
409. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
410. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
cccgagcagggcgtcgccgtcgccgcgcagc Protospacer
. ****** *************** *. *
411. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcaggccgtcgcggtcgcccgcggtg Protospacer
.*********.****** ****** * *.
412. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
413. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
414. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtgctggagggcgtcgccttcgccgcccgcg Protospacer
. * * *** ******* ***********
415. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
416. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
417. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atagatcaggtcgtcgccggcgccgccccgg Protospacer
* * ************* ********
418. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP025584 (Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctgcagccggtcatcgccgtcgccgccgatc Protospacer
**** ****.************** ..*
419. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacaggatgtcgtcgccgtcgccgccgccg Protospacer
.. *** * ****************** *
420. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
cgcgagcaggtcgtcgccggtgccgccgtcg Protospacer
*. *************** .****** *
421. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
422. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
cccgagcagggcgtcgccgtcgccgcgcagc Protospacer
. ****** *************** *. *
423. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggtcagcaggccgtcgcggtcgcccgcggtg Protospacer
.*********.****** ****** * *.
424. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
425. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
aaccaggaggtcgtcgccggcgccgccgttg Protospacer
*..*** ************ ******* .
426. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_007100 (Pseudomonas aeruginosa plasmid Rms149, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgcc--gcccgcc CRISPR spacer
gatcagcaggtcgtggccgtcgcccaggttg-- Protospacer
..************ ********* * ..*
427. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP026928 (Agrobacterium tumefaciens strain 1D1609 plasmid pAt1D1609b, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggccagcacgtcgtcgccttcgccgccgatg Protospacer
.*.***** ********* ******** ..
428. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
429. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
430. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
431. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
432. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
433. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
434. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
435. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
436. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
437. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtgcagcgggtcgtcgccgtcgccgatcccg Protospacer
. ****.***************** .* *
438. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
439. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
440. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
441. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
442. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
443. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
444. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
445. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
446. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
447. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
448. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
449. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
450. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
451. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
452. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
453. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
454. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
455. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
456. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
457. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
458. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
459. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
460. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
461. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
462. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
463. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccggcgccgccgttc Protospacer
. ***********.**** ******* .*
464. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to KX550443 (Mycobacterium phage Magnito, complete genome) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctcgatcaggacgtagccgtcgccgcccgct Protospacer
. * **** *** ***************.
465. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_028941 (Mycobacterium phage Turj99, complete genome) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctcgatcaggacgtagccgtcgccgcccgct Protospacer
. * **** *** ***************.
466. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ggaaaacatgtcgtcgccgccgccgcccgat Protospacer
.* *.** **********.********* .
467. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctggatcaggtcggcgccgtcgacgcccggc Protospacer
* ******* ******** ****** *
468. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 8, identity: 0.742
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
cagcagcaggtcgacgccatcgccgcgctgc Protospacer
. ********** ****.******* * *
469. spacer 2.1|2895907|33|NZ_LN832559|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.727
caccatcgacatccacggcactcgcatccgcct CRISPR spacer
ttccatcgacatccacggcatccgcaagagttt Protospacer
. ******************..**** *..*
470. spacer 2.21|2897235|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 9, identity: 0.735
ctgccgccatcctgcagggcatccacgcccgcgc CRISPR spacer
gcgctcaccgcctgcaggccgtccacgcccgcgc Protospacer
.**. * ******** *.*************
471. spacer 2.21|2897235|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 9, identity: 0.735
ctgccgccatcctgcagggcatccacgcccgcgc CRISPR spacer
gcgctcaccgcctgcaggccgtccacgcccgcgc Protospacer
.**. * ******** *.*************
472. spacer 2.21|2897235|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032703 (Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
ctgccgccatcctgcagggcatccacgcccgcgc CRISPR spacer
atgccgctctcctgcagggcatccagcgcggcat Protospacer
******. **************** * **..
473. spacer 2.25|2897500|34|NZ_LN832559|CRISPRCasFinder,CRT matches to MT952845 (Microbacterium phage GardenState, complete genome) position: , mismatch: 9, identity: 0.735
cggccgtcttggcccccttctcgacaatcgcctc CRISPR spacer
cgaggatggcggcccccgtctcgacaagcgcctc Protospacer
**. .* .******* ********* ******
474. spacer 2.28|2897700|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 9, identity: 0.743
gggtaaggggtggtgaccagcgccgcgaaattgtc CRISPR spacer
cagcaaggggtggtaaccagcgtcgcgaatacggc Protospacer
.*.**********.*******.****** .* *
475. spacer 2.29|2897767|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.727
acgccatcctcgccgaaatggaggcgctgaaat CRISPR spacer
gcgccatcttcgccgaaatcgaggcggaggcgc Protospacer
.*******.********** ****** *. ..
476. spacer 2.29|2897767|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727
acgccatcctcgccgaaatggaggcgctgaaat CRISPR spacer
tcgccttccgcgccgaaatggaggctggcaaga Protospacer
**** *** *************** **.
477. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023450 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
ttccaccggccttgcgcccgagcgcccgccac Protospacer
* *. .***.**************** **
478. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
479. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
agaacgccgcctcgtgaccgagcgcccgcaac Protospacer
. ..* .*.*****.* ***************
480. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
481. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
482. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
483. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
484. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018225 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
ttccaccggccttgcgcccgagcgcccgccac Protospacer
* *. .***.**************** **
485. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
486. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
487. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
488. spacer 2.35|2898162|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
489. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023450 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
ttccaccggccttgcgcccgagcgcccgccac Protospacer
* *. .***.**************** **
490. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
491. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
agaacgccgcctcgtgaccgagcgcccgcaac Protospacer
. ..* .*.*****.* ***************
492. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
493. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
494. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
495. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
496. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018225 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
ttccaccggccttgcgcccgagcgcccgccac Protospacer
* *. .***.**************** **
497. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
498. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
499. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
500. spacer 2.36|2898226|32|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gtggcctcacctcgcgcccgagcgcccgcaac CRISPR spacer
tgaagcgcacctcgcgccccagggcccgcacc Protospacer
.. * ************ ** ******* *
501. spacer 2.38|2898356|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 9, identity: 0.735
cagcgcacagccttcggcggcaaggtttcgggcc CRISPR spacer
cagcgcacaaccttcggcgtcaagatcgagcacg Protospacer
*********.********* ****.*. * .*
502. spacer 2.38|2898356|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 9, identity: 0.735
cagcgcacagccttcggcggcaaggtttcgggcc CRISPR spacer
cagcgcacaaccttcggcgtcaagatcgagcacg Protospacer
*********.********* ****.*. * .*
503. spacer 2.44|2898752|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.735
tagacagcgcggtcgcgccaagcaggacaccgct CRISPR spacer
ccagcagcgcggtcgcccccagcaggacggcggt Protospacer
. ..************ ** ********. ** *
504. spacer 2.45|2898818|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.743
gtcaggccagccccgccgcccatgacggcgaggct CRISPR spacer
tggagagcggccccgccgccgatgacggggaggcg Protospacer
**. *.*********** ******* *****
505. spacer 2.46|2898885|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 9, identity: 0.735
cggatgcgcgcatggacgcccgcaacgagcgcgg CRISPR spacer
cgttccaaggcatggatgcccgcgacgagcgcgg Protospacer
** . . *******.******.**********
506. spacer 2.70|2900472|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047182 (Rathayibacter festucae strain VKM Ac-2802 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
cgcagatcgtgcgctcgaaatgctcgacagagcc CRISPR spacer
gtcagatcgcgcgctcgaaatgatcgacctactt Protospacer
*******.************ ***** * ..
507. spacer 2.70|2900472|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN586025 (Mycobacterium phage Mdavu, complete genome) position: , mismatch: 9, identity: 0.735
cgcagatcgtgcgctcgaaatgctcgacagagcc CRISPR spacer
ctgcgatcgcgcgctcgaaatcctcgacagcctg Protospacer
* *****.*********** ******** .
508. spacer 2.70|2900472|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to KT281789 (Mycobacterium phage Enkosi, complete genome) position: , mismatch: 9, identity: 0.735
cgcagatcgtgcgctcgaaatgctcgacagagcc CRISPR spacer
ctgcgatcgcgcgctcgaaatcctcgacagcctg Protospacer
* *****.*********** ******** .
509. spacer 2.70|2900472|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MH020245 (Mycobacterium phage SgtBeansprout, complete genome) position: , mismatch: 9, identity: 0.735
cgcagatcgtgcgctcgaaatgctcgacagagcc CRISPR spacer
ctgcgatcgcgcgctcgaaatcctcgacagcctg Protospacer
* *****.*********** ******** .
510. spacer 2.70|2900472|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to KX808132 (Mycobacterium phage Amelie, complete genome) position: , mismatch: 9, identity: 0.735
cgcagatcgtgcgctcgaaatgctcgacagagcc CRISPR spacer
ctgcgatcgcgcgctcgaaatcctcgacagcctg Protospacer
* *****.*********** ******** .
511. spacer 2.70|2900472|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MH399770 (Mycobacterium phage Biglebops, complete genome) position: , mismatch: 9, identity: 0.735
cgcagatcgtgcgctcgaaatgctcgacagagcc CRISPR spacer
ctgcgatcgcgcgctcgaaatcctcgacagcctg Protospacer
* *****.*********** ******** .
512. spacer 2.70|2900472|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MF919518 (Mycobacterium phage LilPharaoh, complete genome) position: , mismatch: 9, identity: 0.735
cgcagatcgtgcgctcgaaatgctcgacagagcc CRISPR spacer
ctgcgatcgcgcgctcgaaatcctcgacagcctg Protospacer
* *****.*********** ******** .
513. spacer 2.80|2901134|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022546 (Streptomyces sp. 11-1-2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
gaccacctcggcccggtgcggcgcatctggggc CRISPR spacer
gaccacatcggcccggcgcggcgctcccccgct Protospacer
****** *********.******* .*. * .
514. spacer 2.80|2901134|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015742 (Shinella sp. HZN7 plasmid pShin-06, complete sequence) position: , mismatch: 9, identity: 0.727
gaccacctcggcccggtgcggcgcatctggggc CRISPR spacer
gaccaccgcagcccggtgcggcgcggcaacagg Protospacer
******* *.**************. * . .*
515. spacer 2.87|2901598|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 9, identity: 0.735
gtcggtgagtcctgatggttgagccgttcgttgc CRISPR spacer
cgcgtattctcctgatggatgagccgttcggtgc Protospacer
** ********* *********** ***
516. spacer 2.89|2901730|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
gttcatggggccgcgaccatctgcgcgacatcct CRISPR spacer
ggtaccaaggccgcgaccaggtgcgcgacatcgt Protospacer
* * ...*********** *********** *
517. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
atccaggtaatcgtcgccctcgccacccttc Protospacer
. .******.**************.**
518. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
atccaggtaatcgtcgccctcgccacccttc Protospacer
. .******.**************.**
519. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
atccaggtaatcgtcgccctcgccacccttc Protospacer
. .******.**************.**
520. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
atccaggtagtcgtcgccctcaccacccttg Protospacer
. .******************.**.** .
521. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
atccaggtaatcgtcgccctcgccacccttc Protospacer
. .******.**************.**
522. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccg----ccgaaa CRISPR spacer
cttcaggaagtcgtcgccgtcgccgggtttc---- Protospacer
***** ********** ****** .*
523. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP019949 (Methylocystis bryophila strain S285 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gcgcaggtcggcgtcgccctcgccgctcgct Protospacer
* ***** * ***************. .
524. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccg----ccgaaa CRISPR spacer
cttcaggaagtcgtcgccgtcgccgggtttc---- Protospacer
***** ********** ****** .*
525. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
tgggtggtggccgtcgccctcgccgccgcgg Protospacer
* ***.*.***************** ..
526. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gccgcggtcgtcgtcgccctcggcgccgtcc Protospacer
* . *** ************* *****
527. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
cttcaggtagtcgtcgccgccgccgatgcgg Protospacer
**************** .***** .* ..
528. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
ccagaagtagtcgtcggcctcgcctccgagc Protospacer
*.********** ******* ****.
529. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gccgcggtcgtcgtcgccctcggcgccgtcc Protospacer
* . *** ************* *****
530. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to MK002701 (Halobacterium phage phiH variant phiH1, complete genome) position: , mismatch: 9, identity: 0.71
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
gttcaggtagtcgtcgccctggacgatcttc Protospacer
* ****************** * ** .
531. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.71
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gtccagcgtgtcgttgccgatgccgctgatc Protospacer
. ***************.* *****.. *
532. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.71
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
gctgagcgtgtcgttgccgaggtcgccggtc Protospacer
. **************.***.****. *
533. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.71
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
ggtcagcgtgtcgttgccagtgccgccggag Protospacer
.. ****************. ******. .
534. spacer 4.4|3050437|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
aagcagcgtgtcgttgccaaggccgccatgc CRISPR spacer
atcgagcgtgtcgttgcccaagccgccggta Protospacer
* ************** *.******.
535. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP048425 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atagagccggtcgtcgccgtcgccaccgtag Protospacer
* *** ****************.**
536. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctgcagcaggtcgttgccgccgccgccgttg Protospacer
***********.****.******* .
537. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgccgccgccgctg Protospacer
. ***********.****.******* .
538. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgccgccgccgctg Protospacer
. ***********.****.******* .
539. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgccgccgccgctg Protospacer
. ***********.****.******* .
540. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgccgccgccgctg Protospacer
. ***********.****.******* .
541. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgccgccgccgctg Protospacer
. ***********.****.******* .
542. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgccgccgccgctg Protospacer
. ***********.****.******* .
543. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ctgcagcaggtcgttgccgccgccgccgttg Protospacer
***********.****.******* .
544. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
545. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
546. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
547. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
548. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcacgtcgtcgccctcgccgccgaag Protospacer
.. ***** ********* ******** .
549. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcacgtcgtcgccctcgccgccgaag Protospacer
.. ***** ********* ******** .
550. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
551. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
552. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gacgagcaggtcgtcgccggcgccgccattg Protospacer
... *************** ******* .
553. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcasgtcgtcgccctcgccgccgnaa Protospacer
.. ***** ********* ********
554. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcacgtcgtcgccctcgccgccgaag Protospacer
.. ***** ********* ******** .
555. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcacgtcgtcgccctcgccgccgaag Protospacer
.. ***** ********* ******** .
556. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtgcatcaggtcgtcgccgtcgtcgccatag Protospacer
. ** ****************.****
557. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
caccagcagatcgtcgccgtcaccgccatag Protospacer
..******.***********.*****
558. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gagcagaaggtcgtcgccgttgccgccgttg Protospacer
.. *** *************.****** .
559. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtcaaggaggtcgtcgccgtcgccgccgagg Protospacer
. . ** ******************** .
560. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ttcgagccggtcgttgccgtcgccgccgcgc Protospacer
. *** ******.************ *
561. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gacgcgcaggtcgtcgccggcgccgtccagc Protospacer
... ************** *****.**. *
562. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaccagcagatcgtcgccgtcgtcgccatag Protospacer
...******.************.****
563. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
564. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcgcagcaggtcgttgccgtcgccaccgctg Protospacer
. ***********.*********.** .
565. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gagcagcaggtcgtcgccgttgccaccgttg Protospacer
.. *****************.***.** .
566. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagaaggtcgtcgccatcgccgccatag Protospacer
. .*** ***********.********
567. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_011960 (Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagaaggtcgtcgccatcgccgccatag Protospacer
. .*** ***********.********
568. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagaaggtcgtcgccatcgccgccatag Protospacer
. .*** ***********.********
569. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaccagcagatcgtcgccgtcgtcgccatag Protospacer
...******.************.****
570. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcccggctggtcgtcgccatcgccgcccagt Protospacer
. .*.** **********.*********. .
571. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
572. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
573. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gttgagcgtgtcgtcgccgtcgccgcctttg Protospacer
. * ***. ******************. .
574. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
575. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
576. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gttgagcgtgtcgtcgccgtcgccgcctttg Protospacer
. * ***. ******************. .
577. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtagagcgtgtcgtcgccgtcgccgccgccg Protospacer
. ***. ****************** *
578. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
cacgagcaggtcgtcgcccgcgccgccaccg Protospacer
.. ************** ******* *
579. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaacagcgtgtcgtcgccgtcgccgccgctg Protospacer
.. ****. ****************** .
580. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gacggccagctcgtcgccgtcgtcgcccgcg Protospacer
... . *** ************.*******
581. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_007100 (Pseudomonas aeruginosa plasmid Rms149, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
atcgagcaggtcatcaccgtcgccgccgtag Protospacer
* . ********.**.***********
582. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_007100 (Pseudomonas aeruginosa plasmid Rms149, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ttcgagcaggtcgtcgccatcgccaccgtcg Protospacer
. **************.*****.** *
583. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagaaggtcgtcgccatcgccgccatag Protospacer
. .*** ***********.********
584. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagaaggtcgtcgccatcgccgccatag Protospacer
. .*** ***********.********
585. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagaaggtcgtcgccatcgccgccatag Protospacer
. .*** ***********.********
586. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP010633 (Phaeobacter inhibens strain P78 plasmid pP78_d, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtagatcaggtcgtcgccgtcgccacccttg Protospacer
. * ******************.*** .
587. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaccagcagatcgtcgccgtcgtcgccatag Protospacer
...******.************.****
588. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtccagaaggtcgtcgccatcgccgccatag Protospacer
. .*** ***********.********
589. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaccagcagatcgtcgccgtcgtcgccatag Protospacer
...******.************.****
590. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaccagcaggtcgtcgccgtcgtcaccataa Protospacer
...*******************.*.**
591. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gaccagcagatcgtcgccgtcgtcgccatag Protospacer
...******.************.****
592. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to MT498055 (Arthrobacter phage Bumble, complete genome) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gacgccgaggtcgtcgccgacgtcgcccgcc Protospacer
... ************ **.********
593. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
594. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
cttcaggaagtcgtcgccgtcgccgggtttc Protospacer
**** *.**************** . .*
595. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
596. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
597. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
caggagcaggtcgaggccgtcgccgccgact Protospacer
. ********* ************ .*.
598. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
cttcaggaagtcgtcgccgtcgccgggtttc Protospacer
**** *.**************** . .*
599. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
600. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
601. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
602. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
603. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
604. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
605. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
606. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gttgagcgtgtcgtcgccgtcgccgcctttg Protospacer
. * ***. ******************. .
607. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
608. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gatcggcaggtcgtcgcagtcgccggcgcgg Protospacer
..**.************ ******* *
609. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP021116 (Rhodobacteraceae bacterium strain G7 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ataaagctggtcgtcgccatcgccgccgtaa Protospacer
* *** **********.********
610. spacer 2.5|2896174|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 10, identity: 0.706
cccattgcccggtgaagctgcggtcgtggtcagc CRISPR spacer
cttcatacccggtgaagctgcggccgcggtcctg Protospacer
*.. *.****************.**.****
611. spacer 2.5|2896174|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 10, identity: 0.706
cccattgcccggtgaagctgcggtcgtggtcagc CRISPR spacer
cttcatacccggtgaagctgcggccgcggtcctg Protospacer
*.. *.****************.**.****
612. spacer 2.5|2896174|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 10, identity: 0.706
cccattgcccggtgaagctgcggtcgtggtcagc CRISPR spacer
cttcatacccggtgaagctgcggccgcggtcctg Protospacer
*.. *.****************.**.****
613. spacer 2.5|2896174|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 10, identity: 0.706
cccattgcccggtgaagctgcggtcgtggtcagc CRISPR spacer
cttcatacccggtgaagctgcggccgcggtcctg Protospacer
*.. *.****************.**.****
614. spacer 2.5|2896174|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 10, identity: 0.706
cccattgcccggtgaagctgcggtcgtggtcagc CRISPR spacer
cttcatacccggtgaagctgcggccgcggtcctg Protospacer
*.. *.****************.**.****
615. spacer 2.5|2896174|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 10, identity: 0.706
cccattgcccggtgaagctgcggtcgtggtcagc CRISPR spacer
cttcatacccggtgaagctgcggccgcggtcctg Protospacer
*.. *.****************.**.****
616. spacer 2.5|2896174|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 10, identity: 0.706
cccattgcccggtgaagctgcggtcgtggtcagc CRISPR spacer
cttcatacccggtgaagctgcggccgcggtcctg Protospacer
*.. *.****************.**.****
617. spacer 2.6|2896240|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_020562 (Sphingomonas sp. MM-1 plasmid pISP1, complete sequence) position: , mismatch: 10, identity: 0.714
cttccagcagcacatcgggcgggatcggcacgccg CRISPR spacer
gtcgcgtgagcacatcggtcgagatcggcacgcgc Protospacer
*. *. ********** **.***********
618. spacer 2.7|2896307|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 10, identity: 0.706
gcgcattcttcagcggatttcggatcgcgagatc CRISPR spacer
aatttcgcgtcagcggatttcggctcgcgcgatc Protospacer
. . . * ************** ***** ****
619. spacer 2.10|2896504|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039924 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129a, complete sequence) position: , mismatch: 10, identity: 0.714
gtgcttgccgcgctgaacgcctcttcggccgtgct- CRISPR spacer
tccattgccgcgctgaatggctcttcgg-catattg Protospacer
. *************.* ******** *.*..*
620. spacer 2.29|2897767|33|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 10, identity: 0.697
acgccatcctcgccgaaatggaggcgctgaaat CRISPR spacer
gcgcgatcttcgccgaaatggaggcagcgtcca Protospacer
.*** ***.****************. .*
621. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018473 (Xanthomonas perforans strain LH3 plasmid pLH3.4, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
622. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018473 (Xanthomonas perforans strain LH3 plasmid pLH3.4, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
623. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU254577 (Pseudomonas aeruginosa strain HN39 plasmid pHN39-SIM, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
624. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019671 (Burkholderia cenocepacia strain VC12308 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
625. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
626. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_014911 (Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
627. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043439 (Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
628. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK671726 (Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
629. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
630. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
631. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019872 (Pseudomonas syringae pv. tomato strain B13-200 plasmid pB13-200A, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
632. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026333 (Pseudomonas sp. XWY-1 plasmid pXWY, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
633. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
634. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014059 (Achromobacter xylosoxidans strain FDAARGOS_147 plasmid, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
635. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN310371 (Pseudomonas monteilii strain QJ20133 plasmid pJ20133-VIM, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
636. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018385 (Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
637. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
638. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
639. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
640. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021651 (Acidovorax sp. T1 plasmid p3-T1, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
641. spacer 2.31|2897899|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714
gtccccgcccgtggatgaggatctgctggtatgag CRISPR spacer
gcgttcgcccgtgcatgaagatctgctggttaccg Protospacer
*. ..******** ****.*********** *
642. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_010627 (Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence) position: , mismatch: 10, identity: 0.706
gccgctgcggcgcgagcgcatcgaattcgtcgat CRISPR spacer
ggatctgcggcgcgagcgcatcgagtacgatctg Protospacer
* ********************.* ** .
643. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MF495478 (Aeromonas salmonicida plasmid pS121-1b, complete sequence) position: , mismatch: 10, identity: 0.706
gccgctgcggcgcgagcgcatcgaattcgtcgat CRISPR spacer
ctcactgctgcgcgagcgcatcgaactcaccctc Protospacer
.*.**** ****************.**..* .
644. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022170 (Aeromonas salmonicida strain S121 plasmid pS121-1a, complete sequence) position: , mismatch: 10, identity: 0.706
gccgctgcggcgcgagcgcatcgaattcgtcgat CRISPR spacer
ctcactgctgcgcgagcgcatcgaactcaccctc Protospacer
.*.**** ****************.**..* .
645. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022170 (Aeromonas salmonicida strain S121 plasmid pS121-1a, complete sequence) position: , mismatch: 10, identity: 0.706
gccgctgcggcgcgagcgcatcgaattcgtcgat CRISPR spacer
ctcactgctgcgcgagcgcatcgaactcaccctc Protospacer
.*.**** ****************.**..* .
646. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 10, identity: 0.706
gccgctgcggcgcgagcgcatcgaattcgtcgat CRISPR spacer
catgcaccgccgctagcgcatcgaattcgtcctc Protospacer
.** ** *** ***************** .
647. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038450 (Aeromonas media strain R50-22 plasmid pAeme6, complete sequence) position: , mismatch: 10, identity: 0.706
gccgctgcggcgcgagcgcatcgaattcgtcgat CRISPR spacer
ctcactgctgcgcgagcgcatcgaactcaccctc Protospacer
.*.**** ****************.**..* .
648. spacer 2.34|2898096|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038450 (Aeromonas media strain R50-22 plasmid pAeme6, complete sequence) position: , mismatch: 10, identity: 0.706
gccgctgcggcgcgagcgcatcgaattcgtcgat CRISPR spacer
ctcactgctgcgcgagcgcatcgaactcaccctc Protospacer
.*.**** ****************.**..* .
649. spacer 2.40|2898488|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.706
gacgttacccttgctcttcggctgatagggcggc CRISPR spacer
gacgttgcccttgctcttcagctggtcgatgatg Protospacer
******.************.****.* *. .
650. spacer 2.48|2899016|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011133 (Citrobacter amalonaticus Y19 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
ttcgcgacatcctccgcgctcagccctagcttgcg CRISPR spacer
ttcgcgacatcctccgctctcaaccaacggagctg Protospacer
***************** ****.** * .*
651. spacer 2.65|2900141|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gtgcgcggctcgcgctgcggcacgaaatgactgg CRISPR spacer
ccccgcggcacgcgctgccgcacgaaatccgcga Protospacer
. ****** ******** ********* .*.
652. spacer 2.70|2900472|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 10, identity: 0.706
cgcagatcgtgcgctcgaaatgctcgacagagcc CRISPR spacer
cggcgatcgtgcggtcgaaatcctcgacgctcat Protospacer
** ********* ******* ******. .
653. spacer 2.75|2900802|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.714
gtcgcgacacggacgcgcggggcgcgggcttgccc CRISPR spacer
acgccgacacgcacgcgcgcggcgcgggctccacg Protospacer
.. ******* ******* **********. *
654. spacer 2.76|2900869|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 10, identity: 0.706
agatcagcctggaatatctaaaaggccagcgcat CRISPR spacer
cttctggcctggaatatcccaaaggccagccgat Protospacer
...************. ********** **
655. spacer 2.77|2900935|35|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714
attccgtgcgcatcggcctcctcgtggacccattc CRISPR spacer
tcgtactgcgcttcggcctcctggtggacccaggc Protospacer
. . ***** ********** ********* *
656. spacer 4.1|3050260|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP007517 (Rubrobacter radiotolerans strain RSPS-4 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.677
ggtcaggtagtcgtcgccctcgccgccgaaa CRISPR spacer
atgcaggtggtcgtggccctcgccgcttccg Protospacer
. *****.***** ***********. .
657. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP039967 (Pseudorhodobacter sp. S12M18 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.677
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
caagagccggtcgtcgccgtcgccaccataa Protospacer
. *** ****************.**
658. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 10, identity: 0.677
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
ccggagcaggtcggcgcggtcgccgccgtga Protospacer
********* *** *********
659. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 10, identity: 0.677
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtagagccggtcggcgccgtcgccgccgttg Protospacer
. *** ***** ************* .
660. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 10, identity: 0.677
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gtagagccggtcggcgccgtcgccgccgttg Protospacer
. *** ***** ************* .
661. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 10, identity: 0.677
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gacgagcaggtcgccgccctcgccgccgagt Protospacer
... *********.**** ******** . .
662. spacer 4.5|3050491|31|NZ_LN832559|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 10, identity: 0.677
agtcagcaggtcgtcgccgtcgccgcccgcc CRISPR spacer
gcggcgctggtcgccgccgtcgccgccctgg Protospacer
. ** *****.**************
663. spacer 2.21|2897235|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 11, identity: 0.676
ctgccgccatcctgcagggcatccacgcccgcgc CRISPR spacer
aacccgccatcctgcagggcatacgcgcggatct Protospacer
******************* *.*** .. .
664. spacer 2.25|2897500|34|NZ_LN832559|CRISPRCasFinder,CRT matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 11, identity: 0.676
cggccgtcttggcccccttctcgacaatcgcctc CRISPR spacer
cggccgtcatggccgccttctcgaaggccaatga Protospacer
******** ***** ********* ...*. .
665. spacer 2.25|2897500|34|NZ_LN832559|CRISPRCasFinder,CRT matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 11, identity: 0.676
cggccgtcttggcccccttctcgacaatcgcctc CRISPR spacer
cggccgtcatggccgccttctcgaaggccaatga Protospacer
******** ***** ********* ...*. .
666. spacer 2.25|2897500|34|NZ_LN832559|CRISPRCasFinder,CRT matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 11, identity: 0.676
cggccgtcttggcccccttctcgacaatcgcctc CRISPR spacer
cggccgtcatggccgccttctcgaaggccaatga Protospacer
******** ***** ********* ...*. .
667. spacer 2.25|2897500|34|NZ_LN832559|CRISPRCasFinder,CRT matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 11, identity: 0.676
cggccgtcttggcccccttctcgacaatcgcctc CRISPR spacer
cggccgtcatggccgccttctcgaaggccaatga Protospacer
******** ***** ********* ...*. .
668. spacer 2.25|2897500|34|NZ_LN832559|CRISPRCasFinder,CRT matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 11, identity: 0.676
cggccgtcttggcccccttctcgacaatcgcctc CRISPR spacer
cggccgtcatggccgccttctcgaaggccaatga Protospacer
******** ***** ********* ...*. .
669. spacer 2.44|2898752|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 11, identity: 0.676
tagacagcgcggtcgcgccaagcaggacaccgct CRISPR spacer
gtcctgccacggccgcgccaagcaggactccgcc Protospacer
.. *.***.*************** ****.
670. spacer 2.65|2900141|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 11, identity: 0.676
gtgcgcggctcgcgctgcggcacgaaatgactgg CRISPR spacer
aacagcggcgcgcgctgcggcaggaaatggagca Protospacer
. ***** ************ ******. .
671. spacer 2.65|2900141|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
gtgcgcggctcgcgctgcggcacgaaatgactgg CRISPR spacer
aacagcggcgcgcgctgcggcaggaaatggagca Protospacer
. ***** ************ ******. .
672. spacer 2.65|2900141|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
gtgcgcggctcgcgctgcggcacgaaatgactgg CRISPR spacer
aacagcggcgcgcgctgcggcaggaaatggagca Protospacer
. ***** ************ ******. .
673. spacer 2.70|2900472|34|NZ_LN832559|CRISPRCasFinder,CRT,PILER-CR matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 11, identity: 0.676
cgcagatcgtgcgctcgaaatgctcgacagagcc CRISPR spacer
gctggcctacgcgctcgaaatgctcgaccgggcc Protospacer
..* ....****************** *.***
