Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT549889 Mycolicibacterium aurum isolate liquid chromosome I 3 crisprs csa3,cas3,WYL,DEDDh,DinG 0 1 1 0

Results visualization

1. NZ_LT549889
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT549889_1 90668-90742 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT549889_2 4538555-4538651 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT549889_3 5740684-5740771 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT549889_1 1.1|90694|23|NZ_LT549889|CRISPRCasFinder 90694-90716 23 NZ_LS974446 Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence 52872-52894 2 0.913

1. spacer 1.1|90694|23|NZ_LT549889|CRISPRCasFinder matches to NZ_LS974446 (Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.913

cgactaggcaccaccacgactcg	CRISPR spacer
caactatgcaccaccacgactcg	Protospacer
*.**** ****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4273096 : 4340656 60 Tupanvirus(26.67%) protease,tRNA,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage