Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT576038 Propionibacterium freudenreichii isolate PFRJS11 chromosome I 3 crisprs csa3,cas3,WYL,DinG,DEDDh 0 2 3 0

Results visualization

1. NZ_LT576038
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT576038_1 1807686-1807784 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT576038_2 2314230-2314341 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT576038_3 2387903-2388010 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT576038_2 2.1|2314270|32|NZ_LT576038|CRISPRCasFinder 2314270-2314301 32 NZ_KU254577 Pseudomonas aeruginosa strain HN39 plasmid pHN39-SIM, complete sequence 93743-93774 8 0.75
NZ_LT576038_2 2.1|2314270|32|NZ_LT576038|CRISPRCasFinder 2314270-2314301 32 CP031732 Stenotrophomonas rhizophila strain GA1 plasmid unnamed3, complete sequence 144379-144410 8 0.75
NZ_LT576038_2 2.1|2314270|32|NZ_LT576038|CRISPRCasFinder 2314270-2314301 32 NZ_AP015031 Pseudomonas putida strain KF715 plasmid pKF715B, complete sequence 216038-216069 8 0.75
NZ_LT576038_3 3.1|2387940|34|NZ_LT576038|CRISPRCasFinder 2387940-2387973 34 CP000663 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence 104107-104140 10 0.706
NZ_LT576038_3 3.1|2387940|34|NZ_LT576038|CRISPRCasFinder 2387940-2387973 34 NZ_CP031752 Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence 50213-50246 10 0.706

1. spacer 2.1|2314270|32|NZ_LT576038|CRISPRCasFinder matches to NZ_KU254577 (Pseudomonas aeruginosa strain HN39 plasmid pHN39-SIM, complete sequence) position: , mismatch: 8, identity: 0.75

ctggccagaaacctctaccccgagccccttga	CRISPR spacer
atccccagaaaccgctaccccgtgcccgcgga	Protospacer
 *  ********* ******** **** . **

2. spacer 2.1|2314270|32|NZ_LT576038|CRISPRCasFinder matches to CP031732 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

ctggccagaaacctctaccccgagccccttga	CRISPR spacer
atccccagaaaccgctaccccgtgcccgcgga	Protospacer
 *  ********* ******** **** . **

3. spacer 2.1|2314270|32|NZ_LT576038|CRISPRCasFinder matches to NZ_AP015031 (Pseudomonas putida strain KF715 plasmid pKF715B, complete sequence) position: , mismatch: 8, identity: 0.75

ctggccagaaacctctaccccgagccccttga	CRISPR spacer
atccccagaaaccgctaccccgtgcccgcgga	Protospacer
 *  ********* ******** **** . **

4. spacer 3.1|2387940|34|NZ_LT576038|CRISPRCasFinder matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 10, identity: 0.706

tcaaggagcggcgtggagcccgccttcgctccag	CRISPR spacer
ctcgaaaccggggtggagccggccttcgctccgg	Protospacer
.. ...* *** ******** ***********.*

5. spacer 3.1|2387940|34|NZ_LT576038|CRISPRCasFinder matches to NZ_CP031752 (Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence) position: , mismatch: 10, identity: 0.706

tcaaggagcggcgtggagcccgccttcgctccag	CRISPR spacer
ctcgaaaccggggtggagccggccttcgctccgg	Protospacer
.. ...* *** ******** ***********.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 310143 : 367315 41 Mycobacterium_phage(27.27%) transposase,holin NA
DBSCAN-SWA_2 1594124 : 1649637 42 Tupanvirus(18.18%) tRNA,protease,transposase NA
DBSCAN-SWA_3 1664146 : 1718209 45 Mycobacterium_phage(22.22%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage