1. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to MW091529 (Bacteriophage sp. 103231, partial genome) position: , mismatch: 2, identity: 0.939
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
atccgacgcaaaaccgcttcgcgcttttgctgg Protospacer
****.*****************.**********
2. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
atccgacgcaaaaccgcttcgtacttttgctgg Protospacer
****.****************.***********
3. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 3, identity: 0.909
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgaacgcaaaaccgcttcgcacttttgctgg Protospacer
.* *****************************
4. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg Protospacer
.* .****************************
5. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg Protospacer
.* .****************************
6. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg Protospacer
.* .****************************
7. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccagacgcaaaaccgcttcgcacttttgctgg Protospacer
.* .****************************
8. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg Protospacer
.* .****************************
9. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg Protospacer
.* .****************************
10. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgctgg Protospacer
.* .****************************
11. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaccgcttcgcacttttgctgg Protospacer
.* .****************************
12. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgaacgcaaaaccgcttcgcatttttgctgg Protospacer
.* *******************.*********
13. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
accggacgcaaaaccgcttcgcactattgctgg Protospacer
*.* .******************** *******
14. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 4, identity: 0.879
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttcggacgcaaaaccgctacgcacttttgctgg Protospacer
** .************* **************
15. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaatcgcttcgcacttttgctgg Protospacer
.* .********.*******************
16. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
17. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgcttcgcacttttgccgg Protospacer
.* .*************************.**
18. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tctggacgcaaaaccgcttcgcacttttgctgg Protospacer
.. .****************************
19. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccagacgcaaaaccgcttcgcacttttgctgt Protospacer
.* .***************************
20. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
21. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
22. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
23. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
24. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
25. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
26. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
27. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
28. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018232 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
29. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
30. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
31. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
32. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
33. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
34. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctgg Protospacer
.* .************* **************
35. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.848
atcca-acgcaaaaccgcttcgcacttttgctgg CRISPR spacer
-tccatttgtaaaaccgcttcgcacctttgctgg Protospacer
**** .*.***************.********
36. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
37. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015740 (Shinella sp. HZN7 plasmid pShin-04, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgcttcgcgcttttgctgg Protospacer
.* .*****************.**********
38. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
39. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
40. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
41. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
42. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
43. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
44. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcggacgcaaaaccgcttcgcatttttgctgg Protospacer
* .******************.*********
45. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
46. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcacttttgctgg Protospacer
.* .************* **************
47. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgaacgcaaaaccgctgcacacttttgctgg Protospacer
.* ************** *.************
48. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgaacgcaaaaccgctgcacacttttgctgg Protospacer
.* ************** *.************
49. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgaacgcaaaaccgctgcacacttttgctgg Protospacer
.* ************** *.************
50. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgaacggaaaaccgcttcgcactttttctgg Protospacer
.* **** ******************* ****
51. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgaacggaaaaccgcttcgcactttttctgg Protospacer
.* **** ******************* ****
52. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgaacggaaaaccgcttcgcacttttcctgg Protospacer
.* **** ******************* ****
53. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgc-aaaaccgcttcgcacttttgctgg CRISPR spacer
-ccggacgcaaaaaccgctgcgcacttttgctgg Protospacer
.* .**** ********* **************
54. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 5, identity: 0.848
atccaacgc-aaaaccgcttcgcacttttgctgg CRISPR spacer
-ccggacgcaaaaaccgctgcgcacttttgctgg Protospacer
.* .**** ********* **************
55. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 5, identity: 0.848
-atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
aattcca-ggaaaaccgcttcgcacttttcctgg Protospacer
**.* * * ******************* ****
56. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 5, identity: 0.848
-atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
aattcca-ggaaaaccgcttcgcacttttcctgg Protospacer
**.* * * ******************* ****
57. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015744 (Shinella sp. HZN7 plasmid pShin-08, complete sequence) position: , mismatch: 5, identity: 0.848
--atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
aaatccg--gcaaaaccgcttcgcgcttttgccgg Protospacer
****. ***************.*******.**
58. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgcgtcgtacttttgctgg Protospacer
.* .************ ***.***********
59. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
gccttccgcaaaaccgcttcacacttttgctgg Protospacer
..*. **************.************
60. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaactgcttcgcacttttgccgg Protospacer
.* .*********.***************.**
61. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
62. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccggttcccacttttgctgg Protospacer
.* .*********** *** ************
63. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 6, identity: 0.818
-atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
aattcca-ggaaaaccgctacgcacttttcctgg Protospacer
**.* * * ********* ********* ****
64. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tcaggacgcaaaaccgctgcgcacttttgctgg Protospacer
. .************* **************
65. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcactcttgctgg Protospacer
.* .************* ******.*******
66. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
67. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tcaggacgcaaaaccgctgcgcacttttgctgg Protospacer
. .************* **************
68. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcactcttgctgg Protospacer
.* .************* ******.*******
69. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
70. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga Protospacer
.* .************* *************.
71. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tcaggacgcaaaaccgctgcgcacttttgctgg Protospacer
. .************* **************
72. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga Protospacer
.* .************* *************.
73. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
74. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcgcttttgctgg Protospacer
.* .************* ***.**********
75. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccgggcgcaaaaccgctgcgcacttttgctgg Protospacer
.* ..************ **************
76. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
77. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
78. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga Protospacer
.* .************* *************.
79. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
80. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaacaccgctgcgcacttttgctgg Protospacer
.* .****** ****** **************
81. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg Protospacer
.* .************* .*************
82. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga Protospacer
.* .************* *************.
83. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaacaccgctgcgcacttttgctgg Protospacer
.* .****** ****** **************
84. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcgcttttgctgg Protospacer
.* .************* ***.**********
85. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg Protospacer
.* .************* .*************
86. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
87. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga Protospacer
.* .************* *************.
88. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
89. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaacaccgctgcgcacttttgctgg Protospacer
.* .****** ****** **************
90. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg Protospacer
.* .************* .*************
91. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga Protospacer
.* .************* *************.
92. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaacaccgctgcgcacttttgctgg Protospacer
.* .****** ****** **************
93. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcgcttttgctgg Protospacer
.* .************* ***.**********
94. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg Protospacer
.* .************* .*************
95. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgctga Protospacer
.* .************* *************.
96. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaacaccgctgcgcacttttgctgg Protospacer
.* .****** ****** **************
97. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacgcgcttttgctgg Protospacer
.* .************* ***.**********
98. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg Protospacer
.* .************* .*************
99. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
100. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
101. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
102. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
103. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgggcgcaaaaccgcttcacacttttgctgg Protospacer
.* ..**************.************
104. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
105. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
106. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcccacttttgctgg Protospacer
.* .************* * ************
107. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
108. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
109. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
110. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
111. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
112. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
113. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgtaaaaccgctgcgcacttttgctgg Protospacer
.* .***.********* **************
114. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaccgctacacacttttgctgg Protospacer
.* .************* *.************
115. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaacgctgcgcacttttgctgg Protospacer
.* .******** **** **************
116. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
117. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
118. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.818
atccaac-gcaaaaccgcttcgcacttttgctgg CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg Protospacer
.* *** * ********* ********* ****
119. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacccacttttgctgg Protospacer
.* .************* * ************
120. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcactcttgctgg Protospacer
.* .************* ******.*******
121. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
122. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
123. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaactgcgtcgcacttttgctgg Protospacer
.* .*********.** ***************
124. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
125. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaacgctgcgcacttttgctgg Protospacer
.* .******** **** **************
126. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaac-gcaaaaccgcttcgcacttttgctgg CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg Protospacer
.* *** * ********* ********* ****
127. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048426 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaacgcttcgcactcttgctgg Protospacer
.* .******** ***********.*******
128. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
129. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccggttcccacttttgctgg Protospacer
.* .*********** *** ************
130. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tcctgacgcaaaaccgcttcacacttttactgg Protospacer
.*..***************.*******.****
131. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
caccatcgcaaaaccgctgcgcacttttgcgcg Protospacer
*** ************ *********** *
132. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaacgctgcgcacttttgctgg Protospacer
.* .******** **** **************
133. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
134. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
135. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.818
atccaac-gcaaaaccgcttcgcacttttgctgg CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg Protospacer
.* *** * ********* ********* ****
136. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
137. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcactcttgctgg Protospacer
.* .************* ******.*******
138. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacccacttttgctgg Protospacer
.* .************* * ************
139. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
140. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
141. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaacgctgcgcacttttgctgg Protospacer
.* .******** **** **************
142. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
143. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.818
atccaac-gcaaaaccgcttcgcacttttgctgg CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg Protospacer
.* *** * ********* ********* ****
144. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctacccacttttgctgg Protospacer
.* .************* * ************
145. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcactcttgctgg Protospacer
.* .************* ******.*******
146. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
147. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
148. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
149. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
150. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaac-gcaaaaccgcttcgcacttttgctgg CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg Protospacer
.* *** * ********* ********* ****
151. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
152. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
153. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgaaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
154. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
155. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
156. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
157. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgtgcacttttgctgg Protospacer
.* .************* .*************
158. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacgcaaaaccgctacacacttttgctgg Protospacer
.* .************* *.************
159. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
160. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttccccggcaaaagcgctgcgcacttttgctgg Protospacer
*** ****** **** **************
161. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
162. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
163. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 6, identity: 0.818
atccaac-gcaaaaccgcttcgcacttttgctgg CRISPR spacer
-ccgaacggaaaaaccgctacgcacttttcctgg Protospacer
.* *** * ********* ********* ****
164. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
165. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
166. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgctgcgcacttttgcggg Protospacer
.* .************* *********** **
167. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgc-aaaaccgcttcgcacttttgctgg CRISPR spacer
-gccggcgcaaaaaccgctgcgcacttttgttgg Protospacer
**..*** ********* **********.***
168. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacgcaaaaccgttgcgcacttttgctgg Protospacer
.* .***********.* **************
169. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttccccggcaaaagcgcttcgcacttttcctgg Protospacer
*** ****** ************** ****
170. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 6, identity: 0.818
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctgg Protospacer
.* .*** ******************* ****
171. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 6, identity: 0.818
atccaac-gcaaaaccgcttcgcacttttgctgg CRISPR spacer
-ccggacggaaaaaccgcttcgcactttttctgg Protospacer
.* .** * ******************* ****
172. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
173. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
174. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
175. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
176. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggatggaaaaccgcttcgcacttttcctgg Protospacer
.* .*.* ******************* ****
177. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
gccggatgcaaaaccgcgtcgcacttttgccgg Protospacer
..* .*.********** ************.**
178. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctcg Protospacer
.* .*** ******************* ** *
179. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
180. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttccggacgaaaaccgcttcgcacttttcctgg Protospacer
***.. ******************* ****
181. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
182. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
183. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
184. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
185. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
186. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggacggaaaaccgcttcgcacttttcctgc Protospacer
.* .*** ******************* ***
187. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
gccggacacaaaaccgctgcgcacttttgctgc Protospacer
..* .**.********** *************
188. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgggcgcgaaaccgctgcgcacttttgctgg Protospacer
.* ..***.******** **************
189. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgggcgcgaaaccgctgcgcacttttgctgg Protospacer
.* ..***.******** **************
190. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccgcccgcaaaaccgcttcacatttttgctgg Protospacer
.* **************.**.*********
191. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcggacgcaaaaccggttcccacttttgctgc Protospacer
* .*********** *** ***********
192. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
193. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP007050 (Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
194. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacggaaaaccgcttcgcacttttcctcg Protospacer
.* .*** ******************* ** *
195. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcctgg Protospacer
* * * ******************* ****
196. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacg--caaaaccgcttcgcacttttgctgg CRISPR spacer
--cggacggaaaaaaccgctacgcacttttcctgg Protospacer
* .*** ********* ********* ****
197. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctggcaaaaccgctgcgcactcttgctgg Protospacer
* * *********** ******.*******
198. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.788
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttcggatggaaaaccgctgcgcacttttcctgg Protospacer
** .*.* ********* ********* ****
199. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggacttaaaaccgcctcgcactttcgctgg Protospacer
.* .** .********.*********.*****
200. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgggcggaaaaccgcttcgcacttttcctga Protospacer
.* ..** ******************* ***.
201. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tttcgcggtaaaaccgcttcgcacttctcctgg Protospacer
*.*. *.*****************.* ****
202. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
203. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
204. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
205. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
206. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tttcgcgggaaaaccgcttcgcacttctcctgg Protospacer
*.*. * *****************.* ****
207. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tttcgcgggaaaaccgcttcgcacttctcctgg Protospacer
*.*. * *****************.* ****
208. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgctaccgcaaaaccgctgcacacttttgcgcg Protospacer
*.* ************ *.********* *
209. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
210. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgctagcgcaaaaccgctgcacacttttgcgcg Protospacer
*.*.************ *.********* *
211. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttaccgcaaaaccgctacgcacttttgcgcg Protospacer
..* ************ *********** *
212. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgctaccgcaaaaccgctgcacacttttgcgcg Protospacer
*.* ************ *.********* *
213. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgctaccgcaaaaccgctgcacacttttgcgcg Protospacer
*.* ************ *.********* *
214. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgctagcgcaaaaccgctgcacacttttgcgcg Protospacer
*.*.************ *.********* *
215. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccgggcggaaaaccgcttcgcacttttcctga Protospacer
.* ..** ******************* ***.
216. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgctagcgcaaaaccgctgcacacttttgcgcg Protospacer
*.*.************ *.********* *
217. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tttcgcgggaaaaccgcttcgcacttcttctgg Protospacer
*.*. * *****************.* ****
218. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
219. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
220. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgggagcgcaaaaccgcttcgcacttttcctca Protospacer
*.********************** ** .
221. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
222. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
223. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
224. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
225. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
226. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggactgaaaaccgctacgcacttttcctgg Protospacer
.* .** ********* ********* ****
227. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
228. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggactgaaaaccgctacgcacttttcctgg Protospacer
.* .** ********* ********* ****
229. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
230. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
231. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
232. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgctgcgcacttttgcgcg Protospacer
..* ************ *********** *
233. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tttcgcgggaaaaccgcttcgcacttctcctgg Protospacer
*.*. * *****************.* ****
234. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgcttcacacttttgcgcg Protospacer
..* **************.********* *
235. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
236. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
237. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgcttcacacttttgcgcg Protospacer
..* **************.********* *
238. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
239. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
240. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
241. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
242. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
243. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
244. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
245. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
246. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
247. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
248. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
249. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
250. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
251. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
252. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
253. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttgcctgggaaaaccgcttcgcacttttcccgg Protospacer
* * * ******************* *.**
254. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
255. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
256. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
257. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
258. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
259. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tttcgcgggaaaaccgcttcgcacttctcctgg Protospacer
*.*. * *****************.* ****
260. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
261. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
262. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
263. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cccggatggaaaaccgctacgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
264. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
265. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tttcgcgggaaaaccgcttcgcacttctcctgg Protospacer
*.*. * *****************.* ****
266. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ttttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
267. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013597 (Rhizobium sp. N741 plasmid pRspN741b, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg Protospacer
** . * *** *************** ****
268. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013501 (Rhizobium esperanzae strain N561 plasmid pRspN561a, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg Protospacer
** . * *** *************** ****
269. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
270. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013507 (Rhizobium sp. N1341 plasmid pRspN1341b, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg Protospacer
** . * *** *************** ****
271. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
272. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013518 (Rhizobium sp. N113 plasmid pRspN113a, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg Protospacer
** . * *** *************** ****
273. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
274. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
275. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013491 (Rhizobium sp. N6212 plasmid pRspN6212a, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg Protospacer
** . * *** *************** ****
276. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
277. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013513 (Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg Protospacer
** . * *** *************** ****
278. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013496 (Rhizobium sp. N621 plasmid pRspN621a, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg Protospacer
** . * *** *************** ****
279. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013591 (Rhizobium sp. N871 plasmid pRspN871a, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg Protospacer
** . * *** *************** ****
280. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttatcgcaaaaccgctgcacacttttgcgag Protospacer
*..* ************ *.********* .*
281. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tccggatggaaaaccgctgcgcacttttcctgg Protospacer
.* .*.* ********* ********* ****
282. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013603 (Rhizobium sp. N731 plasmid pRspN731b, complete sequence) position: , mismatch: 8, identity: 0.758
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcctgggaaaacccgcttcgcacttttcctgg Protospacer
** . * *** *************** ****
283. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg Protospacer
... ************ *********** *
284. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttagcgcaaaaccgctgcacacttttgcgcg Protospacer
..*.************ *.********* *
285. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg Protospacer
... ************ *********** *
286. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg Protospacer
..* ************ *.********* *
287. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
*... ************ *.********* *
288. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg Protospacer
... ************ *********** *
289. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg Protospacer
... ************ *********** *
290. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg Protospacer
..* ************ *.********* *
291. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg Protospacer
... ************ *********** *
292. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015740 (Shinella sp. HZN7 plasmid pShin-04, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
tgcgagcgcaaaaccgcttcgcgcctttgcgac Protospacer
* *.****************.*.***** .
293. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg Protospacer
..* ************ *.********* *
294. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgtgatcgcaaaaccgctgcacacttttgcgcg Protospacer
. * ************ *.********* *
295. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttttcgcaaaaccgctgcgcacttttgcgcg Protospacer
.. ************ *********** *
296. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgcatcacacttttgcgcg Protospacer
..* *********** **.********* *
297. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg Protospacer
..* ************ *.********* *
298. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgcaacgcacttttgcgcg Protospacer
..* *********** *********** *
299. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcgcacttttgcgcg Protospacer
... ************ *********** *
300. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttagcgcaaaaccgctgcacacttttgcgcg Protospacer
..*.************ *.********* *
301. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcgcacttttgcgcg Protospacer
... ************ *********** *
302. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg Protospacer
..* ************ *.********* *
303. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaagccgcttcgcacttttgcgcg Protospacer
... ******.***************** *
304. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg Protospacer
..* ************ *.********* *
305. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cggtatcgcaaaaccgctccacacttttgcgcg Protospacer
.* ************.*.********* *
306. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttagcgcaaaaccgctgcacacttttgcgcg Protospacer
..*.************ *.********* *
307. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg Protospacer
..* ************ *.********* *
308. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgtaaccgcaaaaccgctgcacacttttgcgcg Protospacer
. * ************ *.********* *
309. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttatcgcaaaaccgctgcacacttttgcgcg Protospacer
..* ************ *.********* *
310. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
311. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
ctttgtcgcaaaaccgctgcacacttttgcgcc Protospacer
*... ************ *.*********
312. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctacacacttttgcgcg Protospacer
... ************ *.********* *
313. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
314. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
315. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
316. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcgaaaccgctgcgcacttttgcgcg Protospacer
... ***.******** *********** *
317. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
318. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
319. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
320. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
321. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctacacacttttgcgcg Protospacer
... ************ *.********* *
322. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
323. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cggtgccgcaaaaccgctgcacacttttgcgcg Protospacer
.. ************ *.********* *
324. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
325. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
326. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgtagtcgcaaaaccgctgcacacttttgcgtg Protospacer
. . ************ *.********* *
327. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
328. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgtagtcgcaaaaccgctgcacacttttgcgtg Protospacer
. . ************ *.********* *
329. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
330. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttctcgcaaaaccgctgcacacttttgcgcg Protospacer
.. ************ *.********* *
331. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgtagtcgcaaagccgctgcgcacttttgcgcg Protospacer
. . ******.***** *********** *
332. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020897 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
333. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NC_007762 (Rhizobium etli CFN 42 plasmid p42a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
334. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
335. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
336. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
337. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
338. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
339. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
340. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
341. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
342. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
343. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
344. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
345. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
346. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
347. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
348. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
349. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
350. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
351. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
352. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
353. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgccgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *
354. spacer 1.1|77384|33|NZ_LT605585|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 10, identity: 0.697
atccaacgcaaaaccgcttcgcacttttgctgg CRISPR spacer
cgttgtcgcaaaaccgctgcacacttttgcgcg Protospacer
... ************ *.********* *