Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT622246 Bacteroides ovatus V975 chromosome I 1 crisprs RT,PD-DExK,PrimPol,cas3,DEDDh,WYL 0 1 2 1

Results visualization

1. NZ_LT622246
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT622246_1 3347746-3347822 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 NZ_LR134423 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 14 2866-2896 7 0.774
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 NC_007501 Lactobacillus phage Lc-Nu, complete genome 30638-30668 7 0.774
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 AY131267 Bacteriophage Lc-Nu, complete genome 30638-30668 7 0.774
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 MH983004 Lactobacillus phage BH1, complete genome 32670-32700 7 0.774
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 NZ_CP004877 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence 52386-52416 7 0.774
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 NZ_CP045273 Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence 1065035-1065065 8 0.742
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 67130-67160 8 0.742
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 NZ_CP014173 Clostridium botulinum strain B609 plasmid pRSJ22_2, complete sequence 37911-37941 8 0.742
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 AP013657 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S32-C172, *** SEQUENCING IN PROGRESS *** 3482-3512 9 0.71
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 MH791414 UNVERIFIED: Aeromonas phage Aswh_1, complete genome 66404-66434 9 0.71
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 AP014421 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S43-C174, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 8851-8881 9 0.71
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 AP013664 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S45-C223, *** SEQUENCING IN PROGRESS *** 5115-5145 9 0.71
NZ_LT622246_1 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder 3347769-3347799 31 AP013658 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S33-C129, *** SEQUENCING IN PROGRESS *** 4640-4670 9 0.71

1. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to NZ_LR134423 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 14) position: , mismatch: 7, identity: 0.774

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
ttttatttgattgaaatatttttgcctggat	Protospacer
 **. ************** ****.***.* 

2. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to NC_007501 (Lactobacillus phage Lc-Nu, complete genome) position: , mismatch: 7, identity: 0.774

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
atcgttttgaatgaaatatacttgtctagca	Protospacer
**. ****** *********.******.. *

3. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to AY131267 (Bacteriophage Lc-Nu, complete genome) position: , mismatch: 7, identity: 0.774

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
atcgttttgaatgaaatatacttgtctagca	Protospacer
**. ****** *********.******.. *

4. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to MH983004 (Lactobacillus phage BH1, complete genome) position: , mismatch: 7, identity: 0.774

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
atcgttttgaatgaaatatacttgtctagca	Protospacer
**. ****** *********.******.. *

5. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to NZ_CP004877 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB431, complete sequence) position: , mismatch: 7, identity: 0.774

attcttttgattgaaatatatttgtctgaaa----	CRISPR spacer
tttcttttgattttaatatatt----tgaaatatt	Protospacer
 ***********  ********    *****    

6. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 8, identity: 0.742

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
tttctttttattgaattatatttgagcgcta	Protospacer
 ******* ****** ********  .*  *

7. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 8, identity: 0.742

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
attcttctgatttaaatatatttttaatatc	Protospacer
******.***** ********** *   *  

8. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to NZ_CP014173 (Clostridium botulinum strain B609 plasmid pRSJ22_2, complete sequence) position: , mismatch: 8, identity: 0.742

attcttttgattgaaatatatttg----tctgaaa	CRISPR spacer
cttcttttaattcaaatatatttgataattt----	Protospacer
 *******.*** ***********    *.*    

9. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to AP013657 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S32-C172, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
tttctcttgatagaaatatatttgataaacc	Protospacer
 ****.***** ************ . .*  

10. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to MH791414 (UNVERIFIED: Aeromonas phage Aswh_1, complete genome) position: , mismatch: 9, identity: 0.71

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
acccttttgattgacatatatttttcctttt	Protospacer
*..*********** ******** **.    

11. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to AP014421 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S43-C174, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 9, identity: 0.71

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
tttctcttgatagaaatatatttgataaacc	Protospacer
 ****.***** ************ . .*  

12. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to AP013664 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S45-C223, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
tttctcttgatagaaatatatttgataaacc	Protospacer
 ****.***** ************ . .*  

13. spacer 1.1|3347769|31|NZ_LT622246|CRISPRCasFinder matches to AP013658 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S33-C129, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71

attcttttgattgaaatatatttgtctgaaa	CRISPR spacer
tttctcttgatagaaatatatttgataaacc	Protospacer
 ****.***** ************ . .*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2582119 : 2661826 59 unidentified_phage(25.0%) tRNA,transposase,integrase attL 2600097:2600112|attR 2667964:2667979
DBSCAN-SWA_2 4236524 : 4273173 52 Bacteroides_phage(12.5%) portal,terminase,transposase,head,integrase attL 4241848:4241863|attR 4267069:4267084
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LT622246.1|WP_004295672.1|5011256_5011679_-|PcfK-like-family-protein 5011256_5011679_- 140 aa aa 40 NA NA No NA