Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT608328 Petrimonas mucosa strain ING2-E5A chromosome I 3 crisprs RT,WYL,DEDDh,cas8b1,cas7,cas5,cas3,cas6,cas1,cas2,cas4,csa3 0 4 20 0

Results visualization

1. NZ_LT608328
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT608328_1 1000078-1007976 TypeI-B ?
108 spacers
cas4,cas2,cas1,cas6,cas3,cas5,cas7,cas8b1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT608328_2 1597563-1597666 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT608328_3 3484337-3484431 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT608328_1 1.14|1001063|34|NZ_LT608328|PILER-CR,CRISPRCasFinder,CRT 1001063-1001096 34 NZ_CP017992 Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-2c5, complete sequence 1924-1957 7 0.794
NZ_LT608328_1 1.14|1001063|34|NZ_LT608328|PILER-CR,CRISPRCasFinder,CRT 1001063-1001096 34 NC_019126 Salmonella enterica subsp. indica plasmid pSARC14-41, complete sequence 37058-37091 8 0.765
NZ_LT608328_1 1.14|1001063|34|NZ_LT608328|PILER-CR,CRISPRCasFinder,CRT 1001063-1001096 34 NZ_CP017586 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ05, complete sequence 18245-18278 8 0.765
NZ_LT608328_1 1.38|1002807|35|NZ_LT608328|CRISPRCasFinder,CRT,PILER-CR 1002807-1002841 35 NZ_CP033227 Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence 7552-7586 9 0.743
NZ_LT608328_1 1.1|1000115|36|NZ_LT608328|PILER-CR,CRISPRCasFinder,CRT 1000115-1000150 36 NZ_CP019232 Bacillus thuringiensis strain YGd22-03 plasmid pYGD36, complete sequence 29353-29388 11 0.694
NZ_LT608328_1 1.106|1007761|34|NZ_LT608328|CRISPRCasFinder,CRT,PILER-CR 1007761-1007794 34 MN693790 Marine virus AFVG_250M668, complete genome 38510-38543 11 0.676

1. spacer 1.14|1001063|34|NZ_LT608328|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017992 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-2c5, complete sequence) position: , mismatch: 7, identity: 0.794 

ttagctt--cgacttgcatatctgtgagcttttgtt	CRISPR spacer
--ggcttaacgccttgcatatctgtgagctgttgag	Protospacer
  .****  ** ****************** ***

2. spacer 1.14|1001063|34|NZ_LT608328|PILER-CR,CRISPRCasFinder,CRT matches to NC_019126 (Salmonella enterica subsp. indica plasmid pSARC14-41, complete sequence) position: , mismatch: 8, identity: 0.765 

ttagctt--cgacttgcatatctgtgagcttttgtt	CRISPR spacer
--gacttaacgccttgcatatctgtgagctgttgag	Protospacer
  ..***  ** ****************** ***

3. spacer 1.14|1001063|34|NZ_LT608328|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017586 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ05, complete sequence) position: , mismatch: 8, identity: 0.765 

ttagctt--cgacttgcatatctgtgagcttttgtt	CRISPR spacer
--ggcttaaagacttgcatatctgtgaactattgag	Protospacer
  .****   *****************.** ***

4. spacer 1.38|1002807|35|NZ_LT608328|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 9, identity: 0.743 

ctttctcgatcagcctcaacacgctcgacatggag	CRISPR spacer
atgcctcgaccagcctcaacgcgctcgacctcaat	Protospacer
 * .*****.**********.******** * .*

5. spacer 1.1|1000115|36|NZ_LT608328|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019232 (Bacillus thuringiensis strain YGd22-03 plasmid pYGD36, complete sequence) position: , mismatch: 11, identity: 0.694 

tctgcttatctttttgttctaaaactaatcttacaa	CRISPR spacer
acagcttatttttttgttttaaaactaattcactcg	Protospacer
 * ******.********.**********..  . .

6. spacer 1.106|1007761|34|NZ_LT608328|CRISPRCasFinder,CRT,PILER-CR matches to MN693790 (Marine virus AFVG_250M668, complete genome) position: , mismatch: 11, identity: 0.676 

tgcgtaattatttccgataacaacgtaatcaaat	CRISPR spacer
gattaaataatttccgatatcaacgtaatctgta	Protospacer
 ..  *** ********** ********** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 412547 : 473986 37 Staphylococcus_phage(33.33%) transposase NA
DBSCAN-SWA_2 619098 : 691027 52 Staphylococcus_phage(13.33%) transposase NA
DBSCAN-SWA_3 817097 : 879839 50 Bacillus_phage(14.29%) transposase,integrase attL 820371:820385|attR 854198:854212
DBSCAN-SWA_4 962614 : 1012452 36 Klosneuvirus(20.0%) transposase NA
DBSCAN-SWA_5 1018807 : 1097699 54 uncultured_virus(28.57%) transposase,tRNA NA
DBSCAN-SWA_6 1164652 : 1199682 27 uncultured_virus(66.67%) integrase,transposase attL 1164291:1164306|attR 1165791:1165806
DBSCAN-SWA_7 1206936 : 1274497 55 Shigella_phage(16.67%) transposase,protease,tail NA
DBSCAN-SWA_8 1654065 : 1732175 60 Staphylococcus_phage(20.0%) transposase,integrase,tRNA,holin attL 1677261:1677277|attR 1701130:1701146
DBSCAN-SWA_9 1800280 : 1917279 88 unidentified_phage(23.08%) transposase,tRNA NA
DBSCAN-SWA_10 1973835 : 1989786 15 Leptospira_phage(66.67%) transposase NA
DBSCAN-SWA_11 2229324 : 2300767 53 uncultured_Mediterranean_phage(18.18%) transposase,tRNA NA
DBSCAN-SWA_12 2312921 : 2351825 26 Leptospira_phage(16.67%) transposase,integrase attL 2310714:2310728|attR 2331769:2331783
DBSCAN-SWA_13 2409052 : 2467152 46 Yersinia_phage(10.0%) transposase,protease NA
DBSCAN-SWA_14 2474865 : 2560481 60 uncultured_Mediterranean_phage(20.0%) transposase,protease,tRNA,integrase attL 2455948:2455963|attR 2564778:2564793
DBSCAN-SWA_15 2572774 : 2627468 43 uncultured_virus(23.08%) transposase NA
DBSCAN-SWA_16 3027224 : 3082431 48 Staphylococcus_phage(25.0%) transposase,tRNA NA
DBSCAN-SWA_17 3314743 : 3354124 31 uncultured_virus(33.33%) transposase NA
DBSCAN-SWA_18 3401716 : 3458776 49 Enterobacteria_phage(16.67%) transposase,tRNA NA
DBSCAN-SWA_19 3479642 : 3530776 40 Norovirus(33.33%) transposase NA
DBSCAN-SWA_20 3547599 : 3622327 54 Wolbachia_phage(22.22%) transposase,tRNA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage