1. spacer 1.2|1786806|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP031031 (Runella sp. SP2 plasmid pSP2_1, complete sequence) position: , mismatch: 7, identity: 0.794
attgaacatgacggaaagcgtc---tccctgtatctg CRISPR spacer
attgaacatgacggagagtgtctcttccctttgt--- Protospacer
***************.**.*** ***** *.*
2. spacer 3.1|1836782|30|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_019919 (Yersinia phage phiR201 complete genome) position: , mismatch: 7, identity: 0.767
gtgcatgatggtcattagtttccgtagatg CRISPR spacer
ggttaatatggacattagtatccgtagatg Protospacer
* .* **** ******* **********
3. spacer 3.7|1837178|30|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011164 (Xanthomonas citri pv. aurantifolii strain FDC 1609 plasmid pXfc37, complete sequence) position: , mismatch: 7, identity: 0.767
gaatttccctacctcgtcacccgctttttg CRISPR spacer
cgttctccctacctcgttacccgcgtttcg Protospacer
. *.************.****** ***.*
4. spacer 3.7|1837178|30|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to KY290947 (Aeromonas phage 3, complete genome) position: , mismatch: 7, identity: 0.767
gaatttccctacctcgtcacccgctttttg CRISPR spacer
gcctcgccccacctcgtcacccccttttta Protospacer
* *. ***.************ ******.
5. spacer 3.8|1837244|30|NZ_LT629973|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
ataaagaaggcgacactgtctcaatcgcga CRISPR spacer
agcaagaaggcgacacggtcgcaatcggtg Protospacer
* ************* *** ****** .
6. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP017192 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_2, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
7. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP018465 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.4, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
8. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NC_005240 (Xanthomonas citri plasmid pXcB, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
9. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP011164 (Xanthomonas citri pv. aurantifolii strain FDC 1609 plasmid pXfc37, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
10. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP011165 (Xanthomonas citri pv. aurantifolii strain FDC 1609 plasmid pXfc32, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
11. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP021022 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pG, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
12. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP021022 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pG, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
13. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP020978 (Xanthomonas phaseoli pv. phaseoli strain CFBP6982 plasmid pD) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
14. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP020978 (Xanthomonas phaseoli pv. phaseoli strain CFBP6982 plasmid pD) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
15. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP011161 (Xanthomonas citri pv. aurantifolii strain FDC 1559 plasmid pXfc43, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
16. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP011162 (Xanthomonas citri pv. aurantifolii strain FDC 1559 plasmid pXfc38, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
17. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NC_007506 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV38, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
18. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP020966 (Xanthomonas phaseoli pv. phaseoli strain CFBP412 plasmid pD, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
cggcgacgatgggttccggggcgcaccgtatcgc Protospacer
*****.************** *** * ** *.
19. spacer 1.15|1787680|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765
tggcatgcttcgccagcattttttgctcgatcgg CRISPR spacer
tgtactgcttcgccagaattatttgctcgataac Protospacer
** *********** *** ********** .
20. spacer 1.15|1787680|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_LR136959 (Alteromonas sp. 76-1 plasmid pAlt76, complete sequence) position: , mismatch: 8, identity: 0.765
tggcatgcttcgccagcattttttgctcgatcgg CRISPR spacer
tctcttatatcgacagcattttttgctcgttcgg Protospacer
* * *.. *** **************** ****
21. spacer 3.5|1837046|30|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 8, identity: 0.733
tgcttgatgaccatggggatgccgtggtct CRISPR spacer
gacttgatgaccatggggatgccccagaga Protospacer
.********************* ..*
22. spacer 3.5|1837046|30|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 8, identity: 0.733
tgcttgatgaccatggggatgccgtggtct CRISPR spacer
agctggatgaccatggtgatgccgacgata Protospacer
*** *********** ******* * .
23. spacer 3.5|1837046|30|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.733
tgcttgatgaccatggggatgccgtggtct CRISPR spacer
ggcctgatgaccatggagatgccggattgg Protospacer
**.************.******* . *
24. spacer 3.5|1837046|30|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_048850 (Mycobacterium phage Cornie, complete genome) position: , mismatch: 8, identity: 0.733
tgcttgatgaccatggggatgccgtggtct CRISPR spacer
ggcctgatgaccatggagatgccggattgg Protospacer
**.************.******* . *
25. spacer 3.5|1837046|30|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.733
tgcttgatgaccatggggatgccgtggtct CRISPR spacer
ggcctgatgaccatggagatgccggattgg Protospacer
**.************.******* . *
26. spacer 3.7|1837178|30|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.733
gaatttccctacctcgtcacccgctttttg CRISPR spacer
ttccttcgctacctcgtcacccgcttcgag Protospacer
.*** ******************. *
27. spacer 3.8|1837244|30|NZ_LT629973|CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
ataaagaaggcgacactgtctcaatcgcga CRISPR spacer
tcgatcaaggcgacactgtctccatcgaca Protospacer
..* **************** **** *
28. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR723671 (Rhizobium flavum strain YW14 plasmid 2) position: , mismatch: 8, identity: 0.765
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
tcttcagaatggcttcttcggtcctgtccacgat Protospacer
* ** .************.** *********
29. spacer 1.4|1786940|33|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to DQ115843 (Cyanobacteria phage AS-1 contig_36 genomic sequence) position: , mismatch: 9, identity: 0.727
tagattccggggtgacgcgggcggaagcgatga CRISPR spacer
tccaccacggggtgacgccggtggaagcgatcg Protospacer
* *.. *********** **.********* .
30. spacer 1.6|1787075|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 9, identity: 0.735
cctcccttacctcgcctccccgcagcctgaaaat----- CRISPR spacer
cctcctgtacctcgcctccccgcag-----agacgccgt Protospacer
*****. ****************** *.*.
31. spacer 1.14|1787613|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to MH622927 (Podoviridae sp. isolate ctdc_1, complete genome) position: , mismatch: 9, identity: 0.735
gcaggggatgccgctgtccatatccgggtaccat CRISPR spacer
ccaggcgatgccgctgcccatatcccagttcagc Protospacer
**** **********.******** .** * ..
32. spacer 4.11|2800839|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 9, identity: 0.735
ccggtcggggaatcccgcacgtattcccg-gtcgc CRISPR spacer
aatatcggggaatccagcacgttttcccatgccg- Protospacer
.*********** ****** *****. *.**
33. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to KJ578771 (Propionibacterium phage PHL082M04, complete genome) position: , mismatch: 9, identity: 0.735
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
tgctgtcgatggtttcttcgatcagctggtccag Protospacer
**.*********.*********** * * *.
34. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to KJ578769 (Propionibacterium phage PHL082M02, complete genome) position: , mismatch: 9, identity: 0.735
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
tgctgtcgatggtttcttcgatcagctggtccag Protospacer
**.*********.*********** * * *.
35. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to MT647607 (Propionibacterium phage phiPA50S, complete genome) position: , mismatch: 9, identity: 0.735
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
tgctgtcgatggtttcttcgatcagctggtccag Protospacer
**.*********.*********** * * *.
36. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to KJ578768 (Propionibacterium phage PHL082M00, complete genome) position: , mismatch: 9, identity: 0.735
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
tgctgtcgatggtttcttcgatcagctggtccag Protospacer
**.*********.*********** * * *.
37. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to KJ578770 (Propionibacterium phage PHL082M03, complete genome) position: , mismatch: 9, identity: 0.735
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
tgctgtcgatggtttcttcgatcagctggtccag Protospacer
**.*********.*********** * * *.
38. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_031003 (Propionibacterium phage Moyashi, complete genome) position: , mismatch: 9, identity: 0.735
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
tgctgtcgatggtttcttcgatcagctggtccag Protospacer
**.*********.*********** * * *.
39. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_018849 (Propionibacterium phage P105, complete genome) position: , mismatch: 9, identity: 0.735
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
tgttgttgatggtttcttcgatcagctggtccag Protospacer
******.*****.*********** * * *.
40. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to KR337648 (Propionibacterium phage SKKY, complete genome) position: , mismatch: 9, identity: 0.735
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
tgttgttgatggtttcttcgatcagctggtccag Protospacer
******.*****.*********** * * *.
41. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_022342 (Propionibacterium phage PHL111M01, complete genome) position: , mismatch: 9, identity: 0.735
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
tgttgttgatggtttcttcgatcagctggtccag Protospacer
******.*****.*********** * * *.
42. spacer 2.1|1801412|34|NZ_LT629973|PILER-CR,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 10, identity: 0.706
tctccgcagccgggagaagaaatcaaaatcacaa CRISPR spacer
tgcgagcagccgggcgacgaaatcaaaatccgtc Protospacer
* . ********* ** ************
43. spacer 2.3|1801547|34|NZ_LT629973|PILER-CR,CRT matches to NC_008741 (Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence) position: , mismatch: 10, identity: 0.706
tccgacccgcacccggagccgggggtcacgcgcc CRISPR spacer
cggcaggcgcacccggtgccggggctcacgcctc Protospacer
. * ********* ******* ****** .*
44. spacer 2.3|1801547|34|NZ_LT629973|PILER-CR,CRT matches to NC_017311 (Desulfovibrio vulgaris RCH1 plasmid pDEVAL01, complete sequence) position: , mismatch: 10, identity: 0.706
tccgacccgcacccggagccgggggtcacgcgcc CRISPR spacer
cggcaggcgcacccggtgccggggctcacgcctc Protospacer
. * ********* ******* ****** .*
45. spacer 2.3|1801547|34|NZ_LT629973|PILER-CR,CRT matches to NC_005863 (Desulfovibrio vulgaris str. Hildenborough plasmid pDV, complete sequence) position: , mismatch: 10, identity: 0.706
tccgacccgcacccggagccgggggtcacgcgcc CRISPR spacer
cggcaggcgcacccggtgccggggctcacgcctc Protospacer
. * ********* ******* ****** .*
46. spacer 4.8|2800642|33|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.697
cgatgatgcgggaaaacgtgtcgggcgtggagg CRISPR spacer
cgatgatgcgggaaagcgtgacggcaccgacca Protospacer
***************.**** *** .*. .
47. spacer 4.9|2800707|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 10, identity: 0.706
gggtactgcacgacattgcgtatgcctgccgacg CRISPR spacer
cgacgcctgacgacattgcggatgcctgcagact Protospacer
*...*. *********** ******** ***
48. spacer 4.9|2800707|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 10, identity: 0.706
gggtactgcacgacattgcgtatgcctgccgacg CRISPR spacer
cgacgcctgacgacattgcggatgcctgcagact Protospacer
*...*. *********** ******** ***
49. spacer 4.9|2800707|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 10, identity: 0.706
gggtactgcacgacattgcgtatgcctgccgacg CRISPR spacer
cgacgcctgacgacattgcggatgcctgcagact Protospacer
*...*. *********** ******** ***
50. spacer 4.9|2800707|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 10, identity: 0.706
gggtactgcacgacattgcgtatgcctgccgacg CRISPR spacer
cgacgcctgacgacattgcggatgcctgcagact Protospacer
*...*. *********** ******** ***
51. spacer 4.9|2800707|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 10, identity: 0.706
gggtactgcacgacattgcgtatgcctgccgacg CRISPR spacer
cgacgcctgacgacattgcggatgcctgcagact Protospacer
*...*. *********** ******** ***
52. spacer 4.9|2800707|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021924 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2) position: , mismatch: 10, identity: 0.706
gggtactgcacgacattgcgtatgcctgccgacg CRISPR spacer
cgacgcctgacgacattgcggatgcctgcagact Protospacer
*...*. *********** ******** ***
53. spacer 4.11|2800839|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtcggggaatcccgcacgtattcccggtcgc CRISPR spacer
aatatcggggaatccagcacgttttcccatgcgg Protospacer
.*********** ****** *****. **
54. spacer 4.13|2800972|34|NZ_LT629973|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047219 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
tgttgtcgatggcttcttcgatcatgtccacgaa CRISPR spacer
gcttgtcgatggcttcatcgatcttgccggtgcc Protospacer
************** ****** **.* ..*
55. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
56. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
57. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
58. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
59. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
60. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
61. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
62. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
63. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
64. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
65. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
66. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcatccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
67. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
68. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
69. spacer 1.9|1787277|34|NZ_LT629973|PILER-CR,CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 11, identity: 0.676
cggcggcgatgggttccgggtcgccggggatggt CRISPR spacer
tgtcggcgatggcgtccgggtcgccggcatccac Protospacer
.* ********* ************* . . ..
