Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT630450 Desulfovibrio piger strain FI11049 isolate FI11049 chromosome I 2 crisprs WYL,DEDDh,csa3 0 1 8 0

Results visualization

1. NZ_LT630450
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT630450_1 1686025-1686111 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT630450_2 2182464-2182552 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT630450_2 2.1|2182492|33|NZ_LT630450|CRISPRCasFinder 2182492-2182524 33 NC_011040 Enterobacteria phage BA14, complete genome 7856-7888 10 0.697

1. spacer 2.1|2182492|33|NZ_LT630450|CRISPRCasFinder matches to NC_011040 (Enterobacteria phage BA14, complete genome) position: , mismatch: 10, identity: 0.697

tccttatgcgggctggcattgtcagcttttggg	CRISPR spacer
cccttatgagggctggcagtgtcaggtagccta	Protospacer
.******* ********* ****** *  .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7785 : 56478 55 Faecalibacterium_phage(28.57%) capsid,transposase,tRNA,tail,plate NA
DBSCAN-SWA_2 148735 : 182414 49 Pseudomonas_phage(22.22%) integrase,transposase,terminase,tail,plate attL 142587:142604|attR 160384:160401
DBSCAN-SWA_3 185586 : 191348 7 Pseudomonas_phage(33.33%) transposase NA
DBSCAN-SWA_4 431340 : 461275 38 Pseudomonas_phage(30.0%) plate,transposase,capsid,tail NA
DBSCAN-SWA_5 595908 : 659906 56 uncultured_Mediterranean_phage(15.38%) transposase,protease,tRNA NA
DBSCAN-SWA_6 1081987 : 1092583 9 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_7 1146296 : 1160036 12 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_8 1812893 : 1898584 66 Lactococcus_phage(12.5%) transposase,integrase,tRNA attL 1837753:1837772|attR 1898784:1898831
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage