1. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_047992 (Microbacterium phage Zeta1847, complete genome) position: , mismatch: 2, identity: 0.929
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctcatcgggctcggcgccgacc Protospacer
******** ***** *************
2. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MH371124 (Microbacterium phage VitulaEligans, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
3. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN428062 (Microbacterium phage TeddyBoy, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
4. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT498051 (Microbacterium phage Jahseh, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
5. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MK620897 (Microbacterium phage Rhysand, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
6. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MH744416 (Microbacterium phage Dongwon, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
7. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT498038 (Microbacterium phage Luxx, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
8. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MH651181 (Microbacterium phage Minima, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
9. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT316458 (Microbacterium phage McShie, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
10. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN284892 (Microbacterium phage Bradley2, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
11. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT316459 (Microbacterium phage Otwor, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
12. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MH045557 (Microbacterium phage BurtonThePup, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
13. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN010759 (Microbacterium phage Ciel, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
14. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MK524502 (Microbacterium phage TimoTea, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
15. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT316462 (Microbacterium phage Danno, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
16. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN428064 (Microbacterium phage Owens, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
17. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN329679 (Microbacterium phage Vanisius, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
18. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MK894434 (Microbacterium phage LaviMo, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
19. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MH045561 (Microbacterium phage PaoPu, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
20. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT776807 (Microbacterium phage Majesty, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
21. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN010755 (Microbacterium phage Slentz, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
22. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT657332 (Microbacterium phage NeumannU, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
23. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN586008 (Microbacterium phage Scrunchy, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
24. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT639642 (Microbacterium phage YertPhresh, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
25. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MH576963 (Microbacterium phage Scamander, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
26. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT498046 (Microbacterium phage Hernandez44, complete genome) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggactcggcgcggatc Protospacer
************** ******** **.*
27. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgc-cgacc CRISPR spacer
atcgagctgatcggcctgggcgcgcgac- Protospacer
* *************** ***** ****
28. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 3, identity: 0.893
aacgagctgatcggcctcggcgc-cgacc CRISPR spacer
atcgagctgatcggcctgggcgcgcgac- Protospacer
* *************** ***** ****
29. spacer 1.3|1426759|28|NZ_LT635457|CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
ccggctgcgcgcattgcctcgccaagcg- CRISPR spacer
ccggctgcgcgcttggcctcgcc-ggcgc Protospacer
************ * ******** .***
30. spacer 1.5|1426887|28|NZ_LT635457|CRISPRCasFinder,CRT matches to AP018278 (Calothrix sp. NIES-4101 plasmid plasmid5 DNA, complete genome) position: , mismatch: 4, identity: 0.857
cgcgagatgtctgagaaaatggtattag CRISPR spacer
cgcgagatgtctgagcaaatgctatttc Protospacer
*************** ***** ****
31. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 4, identity: 0.857
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gacgagccgatcgacctcggcgccgacg Protospacer
.******.*****.*************
32. spacer 1.19|1427783|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MF001358 (Enterococcus phage EF1, partial genome) position: , mismatch: 4, identity: 0.857
caacctcagaatccaactcaatatgaac CRISPR spacer
caacctcataatccaactcaatatgcct Protospacer
******** **************** .
33. spacer 1.19|1427783|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MF001361 (Enterococcus phage EF5, partial genome) position: , mismatch: 4, identity: 0.857
caacctcagaatccaactcaatatgaac CRISPR spacer
caacctcataatccaactcaatatgcct Protospacer
******** **************** .
34. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to KU530220 (Streptomyces phage Xkcd426, complete genome) position: , mismatch: 4, identity: 0.857
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgcgatcaccgcccacaacggg Protospacer
*******************.**** *
35. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 4, identity: 0.857
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgcaatcaccgccgacaacggc Protospacer
*********.********* **** * *
36. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 4, identity: 0.857
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgcaatcaccgccgacaacggc Protospacer
*********.********* **** * *
37. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_034248 (Rhizobium phage RHEph10, complete genome) position: , mismatch: 4, identity: 0.857
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgtgatgaccgcctacaacgcc Protospacer
********.*** *********** *.*
38. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 4, identity: 0.857
cgccgacgcgatcaccgcctacaaggtc-- CRISPR spacer
cgccaacgcgatcacctcctaca--gtcag Protospacer
****.*********** ****** ***
39. spacer 1.40|1429127|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 4, identity: 0.857
cgcgacggtgataccgagcgtgacgatg CRISPR spacer
ctcgacggtgatatcgagcgtgacattg Protospacer
* ***********.**********. **
40. spacer 1.46|1429511|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 4, identity: 0.857
catcgcgtgctcggggcgatgacgctgc CRISPR spacer
gaacgcgtgctcggggcgatggcgccgc Protospacer
* ******************.***.**
41. spacer 1.46|1429511|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012267 (Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence) position: , mismatch: 4, identity: 0.857
catcg-cgtgctcggggcgatgacgctgc CRISPR spacer
-atggccgtgctcggcgcgctgacgctgc Protospacer
** * ********* *** *********
42. spacer 1.3|1426759|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 5, identity: 0.821
ccggctgcgcgcattgcctcgccaagcg CRISPR spacer
ccggcagcgcggattgcctcgccgctcg Protospacer
***** ***** ***********. **
43. spacer 1.9|1427143|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 5, identity: 0.821
cgcctgcggttaggacgaagatcgtcgc CRISPR spacer
cgcctgcggccaggacgaagatccgcgt Protospacer
*********..************ **.
44. spacer 1.10|1427207|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 5, identity: 0.821
aaggcatggctgagcgcgacctggcggg CRISPR spacer
gcggcatcggtgagcgcgacctggcggc Protospacer
. ***** * *****************
45. spacer 1.10|1427207|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 5, identity: 0.821
aaggcatggctgagcgcgacctggcggg CRISPR spacer
aagacatggctgagcgcgatctggagat Protospacer
***.***************.**** *.
46. spacer 1.10|1427207|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049319 (Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence) position: , mismatch: 5, identity: 0.821
aaggcatggctgagcgcgacctggcggg CRISPR spacer
aagacatggctgagcgcgatctggagat Protospacer
***.***************.**** *.
47. spacer 1.10|1427207|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049319 (Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence) position: , mismatch: 5, identity: 0.821
aaggcatggctgagcgcgacctggcggg CRISPR spacer
aagacatggctgagcgcgatctggagat Protospacer
***.***************.**** *.
48. spacer 1.10|1427207|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049322 (Caballeronia sp. SBC2 plasmid pSBC2-6, complete sequence) position: , mismatch: 5, identity: 0.821
aaggcatggctgagcgcgacctggcggg CRISPR spacer
aagacatggctgagcgcgatctggagat Protospacer
***.***************.**** *.
49. spacer 1.14|1427463|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 5, identity: 0.821
atgcagttgcttgaggtcatcgaggctg CRISPR spacer
caggagttgcttgacgtcgtcgaggctg Protospacer
* ********** ***.*********
50. spacer 1.14|1427463|28|NZ_LT635457|CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
atgcagttgcttgaggtcatcgaggctg CRISPR spacer
aagcagttgcttgaggtgatcgagcatt Protospacer
* *************** ****** *
51. spacer 1.14|1427463|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 5, identity: 0.821
atgcagttgcttgaggtcatcgaggctg CRISPR spacer
gtgtacttgcttgaggtcatcgagcttg Protospacer
.**.* ****************** .**
52. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgtgagctgttcggccccggcgccgacc Protospacer
..****** ******.***********
53. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgagctgatcggcctcgcctccgtga Protospacer
******************* * ***
54. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cttgagctgatcggcctcggcgcggtcc Protospacer
.******************** * **
55. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgggagctgatccgcctcggcgccgaac Protospacer
. ********* ************* *
56. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcgtgctgttcggcctcggcgccgacg Protospacer
.** **** *****************
57. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
caggagctgatcggccttggcgccgcca Protospacer
* **************.******* *
58. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
caggagctgatcggccttggcgccgcca Protospacer
* **************.******* *
59. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
caggagctgatcggccttggcgccgcca Protospacer
* **************.******* *
60. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gacctgctgctcggcctcggcgccgacg Protospacer
.** **** *****************
61. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
tacgagctgaccggccgcggcgccaagc Protospacer
*********.***** *******.* *
62. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 5, identity: 0.821
aacgagctgatcggcctcggcgccgacc CRISPR spacer
tacgagctgaccggccgcggcgccaagc Protospacer
*********.***** *******.* *
63. spacer 1.18|1427719|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821
aaagggcagtgcgtcacgccgcgattct CRISPR spacer
aagggccagtgcgtcacgccgcgtgtca Protospacer
**.** ***************** **
64. spacer 1.24|1428103|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_047955 (Pseudomonas phage Nerthus, complete genome) position: , mismatch: 5, identity: 0.821
cgctccacctccacgtctcggatgcagt CRISPR spacer
acatccacctccacgtcgcggatgcaat Protospacer
************** ********.*
65. spacer 1.24|1428103|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP030365 (Salinibacter ruber strain M1 plasmid pSR116, complete sequence) position: , mismatch: 5, identity: 0.821
cgctccacctccacgtctcggatgcagt CRISPR spacer
ccgttcacctccacgtcccggatgcggt Protospacer
* *.************.*******.**
66. spacer 1.33|1428679|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.821
ttgcgttgaccccgcacgcatcggcggc CRISPR spacer
acgcgttcaccccgcaggcatcggcggt Protospacer
.***** ******** **********.
67. spacer 1.33|1428679|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.821
-ttgcgttgaccccgcacgcatcggcggc CRISPR spacer
gccgc-tggaccccgcgcgcatcggcggc Protospacer
..** * ********.************
68. spacer 1.33|1428679|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.821
-ttgcgttgaccccgcacgcatcggcggc CRISPR spacer
gccgc-tggaccccgcgcgcatcggcggc Protospacer
..** * ********.************
69. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
ctccgacgggatcaccacctacaagacc Protospacer
* ****** *******.********..*
70. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 5, identity: 0.821
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cttcgacgcgctcgccgcctacaaggac Protospacer
* .******* **.************ *
71. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MF975638 (Streptomyces phage Abt2graduatex2, complete genome) position: , mismatch: 5, identity: 0.821
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
ggccgacgcgatcaccgcgcacaacggc Protospacer
***************** .**** * *
72. spacer 1.38|1428999|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.821
agctgacctgcttcgaggtctcggatct CRISPR spacer
tgctgacctgcttcgaggtcccggcgcc Protospacer
*******************.*** *.
73. spacer 1.38|1428999|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.821
agctgacctgcttcgaggtctcggatct CRISPR spacer
tgctgacctgcttcgaggtcccggcgcc Protospacer
*******************.*** *.
74. spacer 1.38|1428999|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP033082 (Glutamicibacter nicotianae strain OTC-16 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
--agctgacctgcttcgaggtctcggatct CRISPR spacer
ttggatg--ctgcttcgcggtctcggatct Protospacer
.* ** ******** ************
75. spacer 1.39|1429063|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NC_009475 (Bradyrhizobium sp. BTAi1 plasmid pBBta01, complete sequence) position: , mismatch: 5, identity: 0.821
ccctgtcgcttctttcacgatcgcgtcg CRISPR spacer
ctccttggcttcgttcacgatcgcgtcg Protospacer
*.*. * ***** ***************
76. spacer 1.46|1429511|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 5, identity: 0.821
-catcgcgtgctcggggcgatgacgctgc CRISPR spacer
gcgtt-cgtgctcggggcgtcgacgctgc Protospacer
*.*. ************* .********
77. spacer 1.2|1426695|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 6, identity: 0.786
cacgcaccgttgagtgcgagcatctggc CRISPR spacer
cgtgcaccgttgagtgcgagggtctgca Protospacer
*..***************** .****
78. spacer 1.6|1426951|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP030762 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
tggggaccatcgaggccgcgcgactcac CRISPR spacer
aaggcaccatcgaggccgcgccacttag Protospacer
.** **************** ***.*
79. spacer 1.7|1427015|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.786
gctacggcgcgccactccccgcgcataa CRISPR spacer
gtgacggcgcgcgacaccccgcgcatgg Protospacer
*. ********* ** **********..
80. spacer 1.8|1427079|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to MT813141 (Klebsiella phage NL_ZS_2, complete genome) position: , mismatch: 6, identity: 0.786
tccacgtgcctaaaccacaggtcgcccg CRISPR spacer
gacacgtgccttaacctcaggtcgcact Protospacer
********* **** ******** *
81. spacer 1.8|1427079|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to MW042808 (Klebsiella phage 066056, complete genome) position: , mismatch: 6, identity: 0.786
tccacgtgcctaaaccacaggtcgcccg CRISPR spacer
gacacgtgccttaacctcaggtcgcact Protospacer
********* **** ******** *
82. spacer 1.8|1427079|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to MW042800 (Klebsiella phage 066037, complete genome) position: , mismatch: 6, identity: 0.786
tccacgtgcctaaaccacaggtcgcccg CRISPR spacer
gacacgtgccttaacctcaggtcgcact Protospacer
********* **** ******** *
83. spacer 1.8|1427079|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to MN176574 (Klebsiella phage vB_KpnP_IME335, complete genome) position: , mismatch: 6, identity: 0.786
tccacgtgcctaaaccacaggtcgcccg CRISPR spacer
gacacgtgccttaacctcaggtcgcact Protospacer
********* **** ******** *
84. spacer 1.10|1427207|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786
aaggcatggctgagcgcgacctggcggg CRISPR spacer
tccacatggctgagcgcgaccgggcgtg Protospacer
.***************** **** *
85. spacer 1.12|1427335|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042262 (Litoreibacter sp. LN3S51 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
gccacgcaagatcgtccgcttcctcagc CRISPR spacer
gccacacaagaccgtccgcttccagctc Protospacer
*****.*****.*********** *
86. spacer 1.12|1427335|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to MF774688 (Salmonella phage SP1a clone contig.00002 genomic sequence) position: , mismatch: 6, identity: 0.786
gccacgcaagatcgtccgcttcctcagc CRISPR spacer
gacctaaaagatcgtcagcttcctcagc Protospacer
* * .. ********* ***********
87. spacer 1.12|1427335|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NC_047754 (Escherichia phage APCEc03, complete genome) position: , mismatch: 6, identity: 0.786
gccacgcaagatcgtccgcttcctcagc CRISPR spacer
gacctaaaagatcatccgcttcctcagc Protospacer
* * .. ******.**************
88. spacer 1.12|1427335|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NC_015269 (Enterobacteria phage SPC35, complete genome) position: , mismatch: 6, identity: 0.786
gccacgcaagatcgtccgcttcctcagc CRISPR spacer
gacctaaaagatcgtcagcttcctcagc Protospacer
* * .. ********* ***********
89. spacer 1.14|1427463|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_011961 (Thermomicrobium roseum DSM 5159 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
atgcagttgcttgaggtcatcgaggctg CRISPR spacer
atgcagttgctggaggtcagcgatcatt Protospacer
*********** ******* *** *
90. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcgagctgatcggcctcggcgcggtag Protospacer
. ********************* *
91. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgggtgctgttcggcctcggcgccgacg Protospacer
. * **** *****************
92. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcatactgatcggcctcggcgccgagc Protospacer
.*. .******************** *
93. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcatactgatcggcctcggcgccgagc Protospacer
.*. .******************** *
94. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcgagctgatcggcatcggcgacgaat Protospacer
. ************* ****** *** .
95. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcatactgatcggcctcggcgccgagc Protospacer
.*. .******************** *
96. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgggtgctgttcggcctcggcgccgacg Protospacer
. * **** *****************
97. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgggtgctgttcggcctcggcgccgacg Protospacer
. * **** *****************
98. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MH744423 (Mycobacterium phage Saguaro, complete genome) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gccgagctgctcggcctcggcggcgatg Protospacer
. ******* ************ ***.
99. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MH047631 (Microbacterium phage Triscuit, complete genome) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgggagctgagcggcctcggcgccggcg Protospacer
. ******* **************.*
100. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
101. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ctggggctgatcggcctcgccgccgtcc Protospacer
*.************** ***** **
102. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ttcgaggtggtcggcctcggcgccggcg Protospacer
**** **.***************.*
103. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ccccggctgatcggccgccgcgccgacc Protospacer
* .*********** * *********
104. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
105. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
106. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgggagctgatccggctcggcgccgaac Protospacer
. ********* * *********** *
107. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ccccggctgatcggccgccgcgccgacc Protospacer
* .*********** * *********
108. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
109. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
110. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gaggtactgatcggcctcgccgccgacg Protospacer
.* * .************* *******
111. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
112. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
113. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
114. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
115. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
agcgagctgatcggcctcctcgccgcgg Protospacer
*.**************** *****
116. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ttcgcgctgatcggcgtcggcgccgtcg Protospacer
** ********** ********* *
117. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
118. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
119. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
120. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgggagctgatccggctcggcgccgaac Protospacer
. ********* * *********** *
121. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ccccggctgatcggccgccgcgccgacc Protospacer
* .*********** * *********
122. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
123. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ccccggctgatcggccgccgcgccgacc Protospacer
* .*********** * *********
124. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
125. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN284907 (Gordonia phage Fireball, complete genome) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gccgagctgatcgacctcggcgacgtcg Protospacer
. ***********.******** ** *
126. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN304822 (Phage 64_12, partial genome) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcgagttgatcggcctcgtcgccgcgc Protospacer
. ****.************ ***** *
127. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_030913 (Gordonia phage Wizard, complete genome) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gccgagctgatcgacctcggcgacgtcg Protospacer
. ***********.******** ** *
128. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
129. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcgagctgctcggcatcggcgccggcg Protospacer
.******* ***** *********.*
130. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ccccggctgatcggccgccgcgccgacc Protospacer
* .*********** * *********
131. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
132. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
133. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gacgagctgatcggcctcgtctccctca Protospacer
.****************** * ** *
134. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_LR134453 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 11, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcgagctgaccggcctcggcgcggtcg Protospacer
.********.************ * *
135. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ctggtgctgatcggcctcggcaccggcc Protospacer
* ****************.***.**
136. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ctggtgctgatcggcctcggcaccggcc Protospacer
* ****************.***.**
137. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
138. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ctggtgctgatcggcctcggcaccggcc Protospacer
* ****************.***.**
139. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgggagctgatccggctcggcgccgaac Protospacer
. ********* * *********** *
140. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcgtgctgatcggcctcggcgcgggcg Protospacer
.** ****************** *.*
141. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_022599 (Micrococcus sp. V7 plasmid pLMV7, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
tacgggctgatcgggctcggcgccctcg Protospacer
***.********* ********* *
142. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ccccggctgatcggccgccgcgccgacc Protospacer
* .*********** * *********
143. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcgtgctgatcggcctcggcgcgggcg Protospacer
.** ****************** *.*
144. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
145. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
tccgagctgatcgacctcggctccgtcg Protospacer
***********.******* *** *
146. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgggagctgatccgtctcggcgccgaac Protospacer
. ********* *.*********** *
147. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ccccggctgatcggccgccgcgccgacc Protospacer
* .*********** * *********
148. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
aacgaactgatcgacctcggcgctcgca Protospacer
*****.*******.*********. .*
149. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 6, identity: 0.786
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcaagctgaccggcctgggcgccgacg Protospacer
. *.******.****** *********
150. spacer 1.20|1427847|28|NZ_LT635457|CRISPRCasFinder,CRT matches to LR743523 (Xylella phage Usme genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.786
tgacctcggcgctgcataccatccgcga CRISPR spacer
tgacctcggcgctgctttccatcagttc Protospacer
*************** * ***** *.
151. spacer 1.22|1427975|28|NZ_LT635457|CRISPRCasFinder,CRT matches to AP014022 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C112A-MedDCM-OCT-S32-C75, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.786
ccagaagccatcatgccaataagcggca CRISPR spacer
tgtgtagccatcatgcacataagcggca Protospacer
. * *********** **********
152. spacer 1.22|1427975|28|NZ_LT635457|CRISPRCasFinder,CRT matches to AP014023 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C112A-MedDCM-OCT-S35-C64, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.786
ccagaagccatcatgccaataagcggca CRISPR spacer
tgtgtagccatcatgcacataagcggca Protospacer
. * *********** **********
153. spacer 1.24|1428103|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 6, identity: 0.786
cgctccacctccacgtctcggatgcagt CRISPR spacer
ggctccaccaccacgtcgcggatgccaa Protospacer
******** ******* ******* .
154. spacer 1.29|1428423|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP044413 (Lactobacillus sp. JM1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cccatccgccaagccctgcaaaagctgc CRISPR spacer
aagatcggccaggccctgcaaaagctgg Protospacer
*** ****.***************
155. spacer 1.33|1428679|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 6, identity: 0.786
ttgcgttgaccccgcacgcatcggcggc CRISPR spacer
agtcgttgcccccgcccgcatcggcggt Protospacer
***** ****** ***********.
156. spacer 1.35|1428807|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN035515 (Leviviridae sp. isolate H4_Bulk_46_scaffold_304 hypothetical protein (H4Bulk46304_000001), hypothetical protein (H4Bulk46304_000002), hypothetical protein (H4Bulk46304_000003), and RNA-dependent RNA polymerase (H4Bulk46304_000004) genes, complete cds) position: , mismatch: 6, identity: 0.786
accccagcagccttccaagaatcagcca CRISPR spacer
aaggcagcagccttccaagcaccagccc Protospacer
* *************** *.*****
157. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
ggaagacgcgatcaccgccgacaaggcg Protospacer
* *************** ******.
158. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgcgatctccgcctacctccgc Protospacer
************* ******** *
159. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP012899 (Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgcgatcaccgcgttcaaccag Protospacer
****************** * ***
160. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgcgatctccgcctacctccgc Protospacer
************* ******** *
161. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgcgatctccgcctacctccgc Protospacer
************* ******** *
162. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
tcgctacgcgatcaccgcctacgagggc Protospacer
. * *****************.*** *
163. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
tcgctacgcgatcaccgcctacgagggc Protospacer
. * *****************.*** *
164. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_005045 (Pseudomonas phage phiKMV, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
165. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT952005 (Aeromonas phage BUCT551, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
ccgtgatgcgatcaccgcctacatggta Protospacer
* .**.**************** ***
166. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MH979674 (Pseudomonas phage RLP, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
167. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to AJ505558 (Bacteriophage phiKMV complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
168. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to KC969441 (UNVERIFIED: Pseudomonas phage MBL, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
169. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN692672 (Pseudomonas phage vB_PaeP_Lx18, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
170. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN615699 (Pseudomonas phage vB_PaeP_SPCG, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
171. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgtgatcaccgcccacagcctg Protospacer
********.**********.***. *
172. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN615698 (Pseudomonas phage vB_PaeP_SPCB, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
173. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgtgatcaccgcccacagcctg Protospacer
********.**********.***. *
174. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgtgatcaccgcccacagcctg Protospacer
********.**********.***. *
175. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to KM067278 (Pseudomonas phage vB_PaeP_PPA-ABTNL, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
176. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN871455 (UNVERIFIED: Pseudomonas phage Pa-B, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
177. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to JX997978 (Pseudomonas phage MPK6, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
178. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN553588 (UNVERIFIED: Pseudomonas phage phiKMVC5-12, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
179. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_047852 (Pseudomonas phage phiNFS, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
180. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN871483 (UNVERIFIED: Pseudomonas phage PaSz-8_45_42k, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
181. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN234225 (Mycobacterium phage Rhinoforte, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
caacggcgcgatcaccgccgacaaggca Protospacer
*. **.************* ******.
182. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to LN610580 (Pseudomonas phage vB_PaeP_PAO1_1-15pyo, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
183. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to EU236438 (Pseudomonas phage PT2, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
184. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to FN263372 (Pseudomonas phage phikF77, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
185. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN553585 (UNVERIFIED: Pseudomonas phage 4phiC20-1 clone 9, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
186. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_047952 (Pseudomonas phage PAXYB1, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
187. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgacgtgatcaccgcccacagcctg Protospacer
********.**********.***. *
188. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN553589 (UNVERIFIED: Pseudomonas phage phiKMVC5(121) clone 13, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
189. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_022091 (Pseudomonas phage MPK7, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
190. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to AM910651 (Pseudomonas phage LUZ19, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
191. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_011105 (Pseudomonas phage PT5, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
192. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN602045 (Pseudomonas phage vB_PaeP_ASP23, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
193. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to KX711710 (Pseudomonas phage vB_Pae-TbilisiM32, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
194. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to KX443696 (Mycobacterium phage Laurie, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
caacggcgcgatcaccgccgacaaggca Protospacer
*. **.************* ******.
195. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN553587 (UNVERIFIED: Pseudomonas phage phiKMVC5(121) clone 4a, complete genome) position: , mismatch: 6, identity: 0.786
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
accggacccgctcaccgcctacaaggtg Protospacer
* *** ** ****************
196. spacer 1.39|1429063|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022993 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN3, complete sequence) position: , mismatch: 6, identity: 0.786
ccctgtcgcttctttcacgatcgcgtcg CRISPR spacer
ggatttcgcttctttaacgatcgcttcg Protospacer
* ********** ******** ***
197. spacer 1.40|1429127|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to KC701493 (Mycobacterium phage CASbig, complete genome) position: , mismatch: 6, identity: 0.786
cgcgacggtgataccgagcgtgacgatg CRISPR spacer
gtagacggtgataccgtgcgtcacgagg Protospacer
************* **** **** *
198. spacer 1.40|1429127|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to JN020142 (Mycobacterium phage Mutaforma13, complete genome) position: , mismatch: 6, identity: 0.786
cgcgacggtgataccgagcgtgacgatg CRISPR spacer
gtagacggtgataccgtgcgtcacgagg Protospacer
************* **** **** *
199. spacer 1.40|1429127|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to MK524525 (Mycobacterium phage Ringer, complete genome) position: , mismatch: 6, identity: 0.786
cgcgacggtgataccgagcgtgacgatg CRISPR spacer
gtagacggtgataccgtgcgtcacgagg Protospacer
************* **** **** *
200. spacer 1.40|1429127|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to MT889384 (Mycobacterium phage STLscum, complete genome) position: , mismatch: 6, identity: 0.786
cgcgacggtgataccgagcgtgacgatg CRISPR spacer
gtagacggtgataccgtgcgtcacgagg Protospacer
************* **** **** *
201. spacer 1.40|1429127|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to KM597531 (Mycobacterium phage Abrogate, complete genome) position: , mismatch: 6, identity: 0.786
cgcgacggtgataccgagcgtgacgatg CRISPR spacer
gtagacggtgataccgtgcgtcacgagg Protospacer
************* **** **** *
202. spacer 1.41|1429191|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022192 (Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
tcgcaggtcatcgatgagatcggagtcg CRISPR spacer
gccggcgtcatcgatgagatcggcgtcg Protospacer
* . ***************** ****
203. spacer 1.41|1429191|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786
tcgcaggtcatcgatgagatcggagtcg CRISPR spacer
aagcaggtcaacgatgagattggagacc Protospacer
******** *********.**** *
204. spacer 1.44|1429383|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034782 (Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence) position: , mismatch: 6, identity: 0.786
cgcacttctttgcagatcgcacgagcgc CRISPR spacer
gatacttcattgctgatcgcacgagcga Protospacer
..***** **** *************
205. spacer 1.46|1429511|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 6, identity: 0.786
catcgcgtgctcggggcgatgacgctgc CRISPR spacer
ctggccgtgctcggggtgatgacgctgg Protospacer
* ***********.**********
206. spacer 1.46|1429511|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 6, identity: 0.786
catcgcgtgctcggggcgatgacgctgc CRISPR spacer
gcgctcgtgctgggggcggtgacgctgc Protospacer
* ****** ******.*********
207. spacer 1.46|1429511|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 6, identity: 0.786
catcgcgtgctcggggcgatgacgctgc CRISPR spacer
gcgcccgtgctcggggcggtggcgctgc Protospacer
* *************.**.******
208. spacer 1.48|1426712|27|NZ_LT635457|PILER-CR matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 6, identity: 0.778
acgcaccgttgagtgcgagcatctggc CRISPR spacer
gtgcaccgttgagtgcgagggtctgca Protospacer
..***************** .****
209. spacer 1.9|1427143|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NC_016601 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED02, complete sequence) position: , mismatch: 7, identity: 0.75
cgcctgcggttaggacgaagatcgtcgc CRISPR spacer
accctgcggttgggacgaagatctgtac Protospacer
*********.*********** ..*
210. spacer 1.9|1427143|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 7, identity: 0.75
cgcctgcggttaggacgaagatcgtcgc CRISPR spacer
accctgcggttgggacgaagatctgtac Protospacer
*********.*********** ..*
211. spacer 1.12|1427335|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.75
gccacgcaagatcgtccgcttcctcagc CRISPR spacer
cagacgcgagatcgtccgctgcctcaaa Protospacer
****.************ *****.
212. spacer 1.12|1427335|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.75
gccacgcaagatcgtccgcttcctcagc CRISPR spacer
cagacgcgagatcgtccgctgcctcaaa Protospacer
****.************ *****.
213. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MT771341 (Gordonia phage DirtyBoi, complete genome) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcgacctgatcggcctcggcgcccctg Protospacer
.*** ****************** .
214. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ctgtcgctgatcgggctcggcgctgacc Protospacer
********* ********.****
215. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP015091 (Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ttcgagctgatcggccccggcgcgctcg Protospacer
**************.****** *
216. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
acgaagctgatcggcctcgccgccggta Protospacer
* .*************** *****..
217. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP044332 (Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ctcgagctgctcggcctcggcgcgcagg Protospacer
******* ************* *
218. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP022750 (Sphingobium hydrophobicum strain C1 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ggcgatctgatcggcctcggcgcaggat Protospacer
..*** ***************** *. .
219. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP009453 (Sphingopyxis sp. 113P3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ggcgatctgatcggcctcggcgcaggat Protospacer
..*** ***************** *. .
220. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ggtctgctgatcggcctcgtcgcccacc Protospacer
... ************** **** ***
221. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgtgagctgatcgacctcggccccgagg Protospacer
..**********.******* ****
222. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_026598 (Mycobacterium phage Milly, complete genome) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgtgagctgatcgacctcggccccgagg Protospacer
..**********.******* ****
223. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgtgagctgatcgacctcggccccgagg Protospacer
..**********.******* ****
224. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgtgagctgatcgacctcggccccgagg Protospacer
..**********.******* ****
225. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MF140411 (Mycobacterium phage Findley, complete genome) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgtgagctgatcgacctcggccccgagg Protospacer
..**********.******* ****
226. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_LN868941 (Nocardia farcinica strain NCTC11134 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcgagctgctcggcctcggcggcgtag Protospacer
. ******* ************ **
227. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_LR134453 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 11, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ttcgagctgatcggccggggcgccggta Protospacer
************** *******..
228. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP031419 (Nocardia farcinica strain W6977 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gtcgagctgctcggcctcggcggcgtag Protospacer
. ******* ************ **
229. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gccgagctgatcggcctcgccgctcccg Protospacer
. ***************** ***. *
230. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP021356 (Rhodococcus sp. S2-17 plasmid pRB29, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcgagctgatcggccagggcgccgcga Protospacer
.************** *******
231. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ggtctgctgatcggcctcgtcgcccacc Protospacer
... ************** **** ***
232. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 7, identity: 0.75
aacgagctgatcggcctcggcgccgacc CRISPR spacer
cgcgagctgatcggccagggcgccgcga Protospacer
.************** *******
233. spacer 1.21|1427911|28|NZ_LT635457|CRISPRCasFinder,CRT matches to AP013578 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C91, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.75
aaatcgaaagatttataaccacccccgg CRISPR spacer
aaatcgaaagatttataaacaaagatag Protospacer
****************** ** ..*
234. spacer 1.24|1428103|28|NZ_LT635457|CRISPRCasFinder,CRT matches to MN693157 (Marine virus AFVG_25M322, complete genome) position: , mismatch: 7, identity: 0.75
cgctccacctccacgtctcggatgcagt CRISPR spacer
tctgtcacctctacgtcacggatgcagt Protospacer
. . .******.***** **********
235. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_LR723678 (Arsenite-oxidising bacterium NT-25 plasmid 2) position: , mismatch: 7, identity: 0.75
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgaggcgatcaccgccgacatctcg Protospacer
****** ************ *** .
236. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 7, identity: 0.75
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
agccgacgcgatctccgcctacctccgc Protospacer
************ ******** *
237. spacer 1.36|1428871|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 7, identity: 0.75
cgccgacgcgatcaccgcctacaaggtc CRISPR spacer
cgccgaggcgatcaccgccgacatctcg Protospacer
****** ************ *** .
238. spacer 1.43|1429319|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to MK044828 (Streptococcus phage 33888, complete genome) position: , mismatch: 7, identity: 0.75
cggaccagatcgaacgctacaaggacga CRISPR spacer
aagacaagatagaacgctacaaggagac Protospacer
.*** **** ************** .
239. spacer 1.46|1429511|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.75
catcgcgtgctcggggcgatgacgctgc CRISPR spacer
gcgggcgtgcgcggggcgatcacgctgg Protospacer
****** ********* ******
240. spacer 1.46|1429511|28|NZ_LT635457|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 7, identity: 0.75
catcgcgtgctcggggcgatgacgctgc CRISPR spacer
ggctgcgtgctcgggccgatgaccctgg Protospacer
...*********** ******* ***
241. spacer 1.13|1427399|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
ggttccttgctctgctacgcgccgttta CRISPR spacer
cgttccttgctctgctacccgcaccagg Protospacer
***************** *** . .
242. spacer 1.13|1427399|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.714
ggttccttgctctgctacgcgccgttta CRISPR spacer
cgttccttgctctgctacccgcaccagg Protospacer
***************** *** . .
243. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 8, identity: 0.714
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gcgaagctgatcggcctcgccgccggta Protospacer
. .*************** *****..
244. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 8, identity: 0.714
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gcgaagctgatcggcctcgccgccggta Protospacer
. .*************** *****..
245. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP013069 (Pannonibacter phragmitetus strain 31801 plasmid p.p-1, complete sequence) position: , mismatch: 8, identity: 0.714
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ccggagctgatcgccctcggcgccctga Protospacer
********** **********
246. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 8, identity: 0.714
aacgagctgatcggcctcggcgccgacc CRISPR spacer
ccggagctgatcgccctcggcgccctga Protospacer
********** **********
247. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP025505 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence) position: , mismatch: 8, identity: 0.714
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gcgaagctgatcggcctcgccgccggta Protospacer
. .*************** *****..
248. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 8, identity: 0.714
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gcgaagctgatcggcctcgccgccggta Protospacer
. .*************** *****..
249. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NC_021910 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetNIM1c, complete sequence) position: , mismatch: 8, identity: 0.714
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gcgcagctgatcggcctcgccgccggta Protospacer
. *************** *****..
250. spacer 1.17|1427655|28|NZ_LT635457|CRISPRCasFinder,CRT matches to NZ_CP030832 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence) position: , mismatch: 8, identity: 0.714
aacgagctgatcggcctcggcgccgacc CRISPR spacer
gcggagctgatcggcctcgccgcccgta Protospacer
. **************** **** ..
