Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT828648 Nitrospira japonica isolate Genome sequencing of Nitrospira japonica strain NJ11 chromosome I 1 crisprs cas3,csa3,RT 0 1 2 0

Results visualization

1. NZ_LT828648
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT828648_1 1325349-1325477 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT828648_1 1.1|1325376|30|NZ_LT828648|CRISPRCasFinder 1325376-1325405 30 NC_018023 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.02, complete sequence 35764-35793 8 0.733

1. spacer 1.1|1325376|30|NZ_LT828648|CRISPRCasFinder matches to NC_018023 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.02, complete sequence) position: , mismatch: 8, identity: 0.733

gtcctcgtgtacggcgaagagaagaaggat	CRISPR spacer
cgcatcgtgtacggcgaaggcaagaagttc	Protospacer
  * ***************. ******  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 394629 : 403234 10 Tupanvirus(16.67%) NA NA
DBSCAN-SWA_2 3991639 : 4001361 8 Paramecium_bursaria_Chlorella_virus(14.29%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage