Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LT962914 Brucella melitensis isolate 1 chromosome 1 1 crisprs WYL,csa3,DEDDh 0 1 3 0
NZ_LT962915 Brucella melitensis isolate 1 chromosome 2 0 crisprs DEDDh,csa3,cas3 0 0 0 0

Results visualization

1. NZ_LT962914
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LT962914_1 1347000-1347082 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LT962914_1 1.1|1347028|27|NZ_LT962914|CRISPRCasFinder 1347028-1347054 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|1347028|27|NZ_LT962914|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

acagatctttccttgcgcgcatcttat	CRISPR spacer
tcagatctttccttgagagcatctgtt	Protospacer
 ************** * ******  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1040533 : 1050554 15 Brucella_phage(37.5%) transposase,integrase attL 1035531:1035571|attR 1050632:1050672
DBSCAN-SWA_2 1119582 : 1131494 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_3 1356202 : 1468271 103 Paracoccus_phage(12.5%) transposase,integrase,tail,portal,holin,protease attL 1351713:1351729|attR 1434657:1434673
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage