Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LS483308 Staphylococcus aureus strain NCTC13137 chromosome 1 5 crisprs cas3,DEDDh,DinG,csa3,WYL 0 2 8 0

Results visualization

1. NZ_LS483308
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483308_1 391104-391205 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483308_2 2164351-2164436 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483308_3 2176744-2176829 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483308_4 2400090-2400183 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483308_5 2433106-2433203 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LS483308_4 4.1|2400123|28|NZ_LS483308|CRISPRCasFinder 2400123-2400150 28 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 286024-286051 7 0.75
NZ_LS483308_3 3.1|2176770|34|NZ_LS483308|CRISPRCasFinder 2176770-2176803 34 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23034-23067 8 0.765
NZ_LS483308_3 3.1|2176770|34|NZ_LS483308|CRISPRCasFinder 2176770-2176803 34 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7567-7600 8 0.765

1. spacer 4.1|2400123|28|NZ_LS483308|CRISPRCasFinder matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

cacttcgcttcggttcgcctgcgctttt	CRISPR spacer
tgtttcgcttcggatcgcctgagcttcc	Protospacer
...********** ******* ****..

2. spacer 3.1|2176770|34|NZ_LS483308|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgcatatctttagctttatagcttttatatgct	Protospacer
******************** *.** .*  **  

3. spacer 3.1|2176770|34|NZ_LS483308|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgaataactttagctttattgttataaacagta	Protospacer
*** *** ****************   *** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 723961 : 731781 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 743751 : 758149 14 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 999981 : 1008454 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 1242526 : 1298767 66 Staphylococcus_phage(55.32%) plate,tRNA,portal,terminase,tail,integrase,holin,capsid,head attL 1262684:1262721|attR 1297361:1297398
DBSCAN-SWA_5 1572602 : 1580914 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_6 1648747 : 1657790 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_7 1788838 : 1848798 61 Staphylococcus_phage(95.45%) protease,tRNA NA
DBSCAN-SWA_8 1940884 : 2037446 117 Staphylococcus_phage(83.54%) tRNA,portal,terminase,protease,tail,integrase,holin,capsid,head attL 2002890:2002907|attR 2027368:2027385
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage